Microarray Probes on PGSC0003DMT400006261

Probe IDChipProbe Sequence
CUST_50078_PI426222305 JHI_St_60k_v1 GGCATACACGGATTGGCCGGTTTAATAAGATTTGGATTGCCAAATTTTCTCAAATTAAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006261

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006261 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10None-----

Transcript Sequence (2628 bp)

>PGSC0003DMT400006261 2628 pgsc_dm_v3.4
AGCAAGCATGCATATAAATATAAAACATTAATATGGAAAATGTTAGTCAAAATAGCAACA
CATATATGTATATATAAAACACATGAAACTTTGAAGTGGGGAGGAAGCATAAGGACACTA
TTGACGTGATGAAGGCTGCTAGACACAAGCGATAACATAGGCGAGCACAAATCTGATTTG
GACAGATGGATGGAGTCGTATCGCAACTCCGAATGTGCTCCAAGTGTACATGTGACAATA
AAGAAAAGAAAAGGATTAGCATAACGCATGTTACTGGTTAAATTACACGAATATACTAAG
TAATCAAGGAGGACCCTCATGCTGAATTCCAATTGAAACAAACCAAGATCCAGTGATGCA
GGGGAAAGAAAATTACACTAAGTGCACATAATGGAAAAGTTTGAGAGAATTGATCATTCC
AAATTTATACTAACTTAACTTATAGCTTTGGGGAAACAAAAGAATTCATATCAAAATAGG
CACATATCATTGTCATTTTAAGGGAAGTAATAGAGAGTTTCTACAGGAAAATGGAATCAA
ACTTAGAAAAGATAAACAAATGTTTTCGGTAGTGAACCCCCCATGCCATACATTTCCAAT
ATATGTTCAAACCGAGTAAACACATACATATAATCATGTTAGCAGGTCACGTAGAACAAC
ATTGGCTCATTTTGAAAATTAAAACAGAGAACTAAAAAAAAATTATGAATCGAATCGCAT
CACTTAGTCAAAGACTCTACAACTATCTTAAAACAGGAAGTAAAATATGAGTTTAATTTG
TTATGATTTGATCATAATAACCAATTAAAACTAAACCCAATTTCATATTAGCAGCAAGTA
TTCAATGCGAGCTAAATACGAGGGAACTTAAAGAAAGACATGGACTAGATTTGAACTATT
TTGGAAGGTAAGAATTTACATCTAGACTTTAAGATTTTATTTTTAGCATACCAACGATCA
ATAGTAGATTTTTAGTTTCATAAGTGAAGCTACAATGAGCTATAATGTTAAACTAAAGGA
AACATGCAACTTGATGTCAAGGTTTTCAACAAGGAACTAATGCATAAAATATGAGATCAC
TTCTATGTTTAGACTTCATCAATTTCATAAACCAAATACGTCATTCTCGAAGGAGTCTAG
AATGGATCAACTGATTCCTCATTACTTAACAGATGCACAGAACAAAGGGAAGAACAAAAT
TTGAGGAGCTAACAGATTCTAAATCAAATCACAATAGAGCAACTGTGTAGCACGGAGTTT
CTTAAGAAAATTCAAAGCAAAACAAGCTTAGATGATAGTCTTTTAACAGGGGACTAGGAT
AGAAAATGTGGAAGCGTAGAAAACATTAACAAATGTATTGAAGTAGAACTTTACTGTTTA
AATCTAACCAAAGAAAGCATTTTTAGATTATTTTTTTTAGAGAGGTAGAACTAGCAGATT
CAAAGATCAATACAACAAGATAGAATGCATTAGCAAAAGAGTATATATCCAGATTACTAT
CAATACATGCAGTGACACATGCGATCCAGGCTTTTAACTAATACTAATGTATAAAATTCC
TAACAAATCTCCACACAAAACAGAAGCAGGAAGTACAGAAACTAATTAGCTCAAGCTTAG
AAATCTAGATCGGCAACATACAGAACATTATAGGAAACGCAACTATCGAAGCAACACATA
GAAGATTACAAGAAAACACAAAACTATCGAAGCAACACAGAGAAAAAGAAAAGTTTACCT
TCTTTGGAGCAGCAAACAAGAGCTTCAACGTCTAGAATTCTAACTTCCAACTCTCTCAAA
CTCGAATTCAAGACCGAAAATCGAAAGATGAGAGAAGATATAAATTTTCTTAAATCTAAT
GCTTGAGGCGTGTTCTATCTCTCTTTTTTCGTTTGTTTTTCGCCACCCCTTGAATGAGAA
CCAAAGGGTTGATTTTATAGTCGAATTTTGGGGGAGGATTCCAATCTTACAACCATCAGA
TTAAGGGGATAACGATCCCAAATCCGATGGTCCTTCACGTTCTTCACCTCTTCAGTCTTA
GCAGTGGCGGTAGTGTGGCTTTTTAGGGCTGTCGTGGTTCAGAAAAGATGTAAAGTTGAC
ACGAGGAGGATATGATTGATGGAGGGTAGGGAGATACGTTGGAGACCACCGGAAATTGCC
ATTTTCCGATGGTCTGTAGGCGAAAGCGCTGGCAGAGGAGAGAGAGATCGATGGGAGAGG
AGAGGAAAAGAGTTTGATGGGAAAGGGGTGATTTTTGGGAAGAGAAAACGTATGGGGAAG
GGAGAAAGTTCTGGAAAAAAGAAAAGTGTGGCTGATGGGTTGTACTTATTTTGGGAAAAG
ATGAAAACTTGGGATTTAATTTGGGCCGTCCGATCATTTGATCGGACGGTTGGTAAAAAT
AGAGAGTTTAAAAATAAATAACATATATACATATATATATATATAGCAAAAGGATGAATT
AATTAAGGCCGTTAGATTAGATTGTAAGGCTGAGATCGAATCTAAAGAAGCACAATCCAT
GTGCTCGCCTACGTGGCATACACGGATTGGCCGGTTTAATAAGATTTGGATTGCCAAATT
TTCTCAAATTAAATTCATTTAAATTATAACTACTTTCTTTATTAAATA