Microarray Probes on PGSC0003DMT400004595

Probe IDChipProbe Sequence
CUST_28114_PI426222305 JHI_St_60k_v1 TTATTGTCCTTTCATTCTTGAGTTTGTTCACTCCTTCGTGCTTAACAGGATCAGGTGAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004595

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004595 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G19950.1 +1 4e-87 272 197/331 (60%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44860.1); Has 338 Blast hits to 330 proteins in 72 species: Archae - 2; Bacteria - 94; Metazoa - 7; Fungi - 0; Plants - 232; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | chr4:10809977-10810942 FORWARD LENGTH=321

Transcript Sequence (1351 bp)

>PGSC0003DMT400004595 1351 pgsc_dm_v3.4
CTCAGATAAGCATAATTTCTTTCACCTACCTCCTCCTCCTCTTCTTCTTCTTCTTCTTCT
TCTTCTCTGGTAAAAAAGATCCAATTTTGAACCAAGAAAGCCATGGATCTGGCACCAGAA
CAGCAACAAAACTTGAGTTTACTCTCACTTTTCAAAGAATCACTTTCCATCCCAAAGAGA
TCTCCACAAACTTTTTACAGAATCACTCTCAGCTTAATCTTGCCACTCTCTTTCGCAATC
TTAGCTCATTCCTTCTTCACCCATCCCATTCTTTCTCAACTCCATGAAAACCCAAGTGCT
TCTCATGCTTCTCAATGGACCAAACTCCTTTTCTACCAATTCTGTTACTTAATTTTCCTC
TTGGCCTTCTCCCTCCTCTCAACCTCTGCTGTTGTCTTCACTGTCGCTTCTCTTTACACT
TCAAAACAAGTATCTTTCTCCTCAATAATCACTGCTCTGCCTAGCATCTTAAGACGCCTC
TTCATTACTTTCATATGGGTTTTCCTCTCCATGCTTGTTTACAACGCTGTCTTGTCCTTT
TTCATTGTACTCATGTTAATTGCCTTTGAGAGCAAAAGCAAAAACAGTATTGCTCTGTTT
TTAGTCTCTGTTTTTCTCCTCTCTGTTTTCTTCCTTGTTGTTCATGTCTACTTAAGTGCT
TTATGGCATCTTGCTAGTGTGATTACTGTTCTTGAACCAATTCAAGGCCTTGCTGCTTTT
AAGAAAAGCTATGAGCTGTTAAAAGGGAAAATTAGAATGGCTTCTGTGTTGGTTTTGGGG
TATTTGGTGATTTTTGGTGTAATTAGTAGTGCTTTTGGTTCAATTGTGGTGGATGGTGGT
GCTAATAAGGATCATGAAGGATACAGTGTTTTTGTTAGGATTGTTGTTGGAGGGATCTTG
ATTGGTGTTCTTGTGGTTGTGATTTTGGTGGGGCTTTTGGTGCAAAGTTTGTTTTATTAT
GTGTGTAAGAGTTATCATAATGAGAGGATTGATAAGAGTGCTTTGTATAATCATCTTGGT
GGGTATTTGGGTGAGTATTATGAACCTCTTAAAGGGAACATGCAAATTGATGATAGCTTC
GAGGTAGAGATGAAAGGTGGAGAGACTGCTTGAAGCTTTTTTTGATGAGTTTTGGTGGTG
ATTGTGTTGAGATAAAAGTAAAATTAATAAATCTTAGCACTTCATTTTCCCTTTTTTATG
TTTAGTTATATGTGTTTTTGTAATGAAATGCAATGCAATCGAATCGATGATTACTTTTCG
TGTATATAACTTAAATGAGATTTTGTATGGTTTATTGTCCTTTCATTCTTGAGTTTGTTC
ACTCCTTCGTGCTTAACAGGATCAGGTGAGG