Microarray Probes on PGSC0003DMT400004307

Probe IDChipProbe Sequence
CUST_28051_PI426222305 JHI_St_60k_v1 TAGCCGCGTCTCTGTACGTATTAGGTAAGGAAATGAAGAATTATACGTATTGCTCAAAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004307

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004307 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14320.1 +3 5e-14 69 26/46 (57%) Zinc finger, C3HC4 type (RING finger) family protein | chr3:4777731-4778345 REVERSE LENGTH=204

Transcript Sequence (764 bp)

>PGSC0003DMT400004307 764 pgsc_dm_v3.4
AATAATTAATCCAAAACTTAGACTTGCATTTATTTGCGTGTAACTTTGTATTGTCGGCAA
TAAGGCGTTCTCATCAAATCATAGTAGATAGAGAGAGAAACATGTATTTTCATTTTGAGC
CATTAGCCACCTTTACAGCTACCGCCACCGCTATTTTCTTAATTTCCACTATCAAATTCC
GTTGGTTCCGTCCCGACAATTATTTGCCGCCGCCGTTCAACGTCCTCGTCGAGGAAATCG
GTTACTGTTACTGTGCCGTGTGCCTCGACGAGGTGAGCGGTGGCGACACGTGTCGACAAC
TGCCCAAGTGCGGCCACGCATTCCACGCGATGTGCGTGGACGCGTGGCTAGAGTGCAATT
GGACGTGCCCAATCTGCAGAAGGCAAGTTACTGATGAACTTCCGAAGAGACAAGGTCAAA
ACACCCTAATTTCTTTTGTTATTTCACGCTGTGAAGAATTTGTGGCTAAGATTAATACTC
GTGCTGAAGAATTCATGATCGTTTTGTTCGAGACCGCTGTTTTAGGCCATCTTTGAATTT
TATTAAGTGTGTATTCATTGATCCGACTAATTCAGATTTGGTTTAATTTTTTTAACCTTT
TGCACAAGTTAACGAGAATGTTTAGTTTAGGCATATTTGTCCTTTTTTTTCCCTTTCTTA
AAGGAACTTTTTGATCGGAATATATGTATAATTGTTAGGTTTAGCCGCGTCTCTGTACGT
ATTAGGTAAGGAAATGAAGAATTATACGTATTGCTCAAAGAAGA