Microarray Probes on PGSC0003DMT400004170

Probe IDChipProbe Sequence
CUST_36836_PI426222305 JHI_St_60k_v1 CCAACAAAGTGAACTTAGTTCAAGTGGCAACTAATGGAGCTATGAAGATTACCTAATTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004170

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004170 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G75590.1 +1 3e-43 147 83/153 (54%) SAUR-like auxin-responsive protein family | chr1:28383250-28383714 REVERSE LENGTH=154

Transcript Sequence (871 bp)

>PGSC0003DMT400004170 871 pgsc_dm_v3.4
CAAACAATAAAACTCTCTTTTTACTCAACTCCATTCTTCTACACATTAATTAGTTGTATT
TGATTATTGGAGATGTCGCCTGAGATCGGAAAATTCAACAGGATTCGTTGCATTGTAAGG
ATCAGTCAGATGCTCCGGCAATGGAAGAAAAGAGCTATATCTTCTTCATCTAAACGCATA
GCTTCTGATATACCTGCCGGACACGTAGCGATCTCGGTAGGCAGTAATTGCCGGAGATTC
GTGGTGCGAGCAAAGTATTTGAATCATCCGATTTTCAGGAAGCTATTAACTCAGGCGGAG
GAAGAGTATGGTTTCTCTAACCATGGAACTTTGGCTATACCTTGCGATGAGTTTTTATTC
GAGGAGATCCTTAGGTTCGTCTCTCGATCTGGATCCAGTAATTGGAATTGTTCGTTAAAT
ATCGATGATTTTCAGAAATCATGCCATGCAAGGTACAGGAATAGTATGGAGAATTTTGGT
GAATCTCGAGCGTTACTGGGTGGATCTACTGAAAAATCAGTGTGTTGAAAAAATTTGAGT
TTTAGGAGTAGAAAATTTGTGATGTTGCAGATGGAGATGGCGAAAAAATAATTGAGTCAT
CCCGAAATGTTTTGCTGACAGACTCCAGATAATTATAAAGAGTGTCTGTTACGTTTCAAA
TACAAAAGTAGGGAATCGAACTGATCACCAACAAAGTGAACTTAGTTCAAGTGGCAACTA
ATGGAGCTATGAAGATTACCTAATTATTATGTTATTCTTTTCTGAAATTTACGTTATACG
TATTTTTTTTTTCTTTGTTCAAGAAAAAGTTGTAAAATTTAATACTAAATTACGTAATTG
ATATATTACTCTTGAAGATTTTCATTTTGTA