Microarray Probes on PGSC0003DMT400004132

Probe IDChipProbe Sequence
CUST_36717_PI426222305 JHI_St_60k_v1 GGTGGCTGCTTTAATTGTGTTGTTACTAATATTGTTGCAGTATCAGTCTACTTTTCTTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004132

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004132 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G21180.1 +2 3e-22 89 68/123 (55%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19875.1); Has 124 Blast hits to 124 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 124; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:9074956-9075351 REVERSE LENGTH=131

Transcript Sequence (575 bp)

>PGSC0003DMT400004132 575 pgsc_dm_v3.4
TCCAAATTCTAATTTTCAAGTAGAAAAAATAAACTTCATATTATACCCTTTTTAATATAT
ATATTTTTTCATGTATCCACATAGAAAAAATACAGCCTCCTCAATCTTGGAGTTTTTTTC
ACTAAATCCTTTACCATATCCAGTTTTATTATTTTTAGCTGTTATTTTTATATTTCTAGG
TATTCAATGGTTTGTTTCCTATGAAGAAGTGATGGAAGCTACTGAAGAAAGTTTTGGTTG
GATACTTATGATTGTGCCACTTGTCTTGTTATTCGCCGTCAAGTGGTTATCCACGGTGGA
CCCACCAGATTGGTTTTTTGGCGGGTCACCGTGGGACCGACGGCGAAGAACGTATCAAAT
GCCGTCGGAAGGAAGCTCACCGTGGGGGGTGGCTGCTTTAATTGTGTTGTTACTAATATT
GTTGCAGTATCAGTCTACTTTTCTTGATATGTGGTTTTTATAATTATAGAGGAATTAATT
AAGTGTGTAAATTATGTAACTATTGTTTGTAATTTATCGAATTATTATTTTCGTTTGGAT
AAGATCAAGATTTTCAGTAAAGTGATTTTCATATA