Microarray Probes on PGSC0003DMT400003608

Probe IDChipProbe Sequence
CUST_1174_PI426222305 JHI_St_60k_v1 CAGATATCTTCATTTCCTAAACTATACCCTCGTTACTCAAGCAAACAGAGAGAAACTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003608

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003608 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g088100.2 +2 4e-156 445 222/226 (98%) genomic_reference:SL2.50ch02 gene_region:44867449-44868915 transcript_region:SL2.50ch02:44867449..44868915- go_terms:GO:0005199 functional_description:Expansin (AHRD V1 ***- Q9ZP31_SOLLC); contains Interpro domain(s) IPR007112 Expansin 45, endoglucanase-like IPR007117 Pollen allergen/expansin, C-terminal
TAIR PP10 AT1G26770.2 +2 1e-125 368 185/226 (82%) expansin A10 | chr1:9259775-9260792 FORWARD LENGTH=259

Transcript Sequence (1297 bp)

>PGSC0003DMT400003608 1297 pgsc_dm_v3.4
TTATTCTCCACGATTGCAGATATCTTCATTTCCTAAACTATACCCTCGTTACTCAAGCAA
ACAGAGAGAAACTTTTTTTTGTTTGAAAATGGCTCTTTTAGGTCTCCTTTTAATGGGAAT
TTCCCTCATGTTTCAATCAGCCCATGGCAATGGCGGTTGGATCAATGCTCATGCCACTTT
TTACGGTGGAGGAGATGCTTCTGGAACTATGGGTGGTGCTTGTGGTTACGGAAATTTATA
CAGCACTGGATACGGTACGAACACTGCTGCGTTGAGTACTGCTCTGTTCAATAACGGGTT
GAGTTGTGGATCGTGTTTTCAGCTAATGTGTGTGAATGCGGGGCAGTACTGCCTGCCGGG
CATAATTACTGTGACAGCCACAAATTTCTGTCCACCAGGAGGGTGGTGTGATCCTCCGCG
CCCTCATTTTGATCTCTCTCAACCTATCTTCTTGCGCATTGCTCAATATAGAGCTGGCAT
CGTTCCTGTTGCCTACAGAAGAGTACCCTGCAGAAGAAGTGGAGGAATTAGATTTACAAT
CAATGGTCACTCTTACTTCAACTTGGTTCTTGTAACAAATGTTGGAGGTGCAGGAGATGT
ACACTCAGTATACATCAAGGGTTCAAGAACTCAATGGCAACCAATGTCAAGAAATTGGGG
CCAAAATTGGCAGAATAACGCTTACCTTAACGGCCAAAGCCTGTCCTTTAAGGTCACTAC
AGGCGATGGTCGCACTGTTGTTTCATACAATGCAGCTCCTAGTTCTTGGTCTTTTGGTCA
GACATTTTCTGGAGGACAATTCCGTTAGAACGCAAATATTTTGCGAAAAAAAAACCAGAA
TTTTCAAGTATACTATTTACTAAAATATTTAATTTTAAATATTATTCTAAGAGTTTGGCC
TTAATTTGAGGGTTTTACTCACCAAAATGTTTGGGAAAAGCGCAGTTTGGCACTTTTTGT
CCATTGTAAAATTGGTCATTCAATTGTGGAAGTAAAAAGAATTTATTCGGCCTACTTTTT
TTTTGGGTGGCTGTTAACGTCTAGGGGGGCGGCAGTTGTGAGCTTTTACTGCTCAATTTA
ATAGTATAAATAGCATTACAATATTGTGTGCATAGAAGAAAAATATCTACTTTTTTTTTT
TACTGTAAAAGAGCTAAGCACTAATTATGCTGAGTATGTATGTACCAATTGTCTCTAGCT
ATTTGTTTGTAAGAAAATGTTACTATAATAATAAAAGGAAACTCCAAGCTGTACTAGGTG
CAATGTCTTATAACGGGCATTCTTTACCTTACAATTG