Microarray Probes on PGSC0003DMT400003250

Probe IDChipProbe Sequence
CUST_52734_PI426222305 JHI_St_60k_v1 ATTGGTGGCATTTTCCCTCAAGGACAATAGTCTTCACAATGAATTCGAGGTCTCCGAGAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003250

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003250 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G02000.1 +3 1e-70 226 118/151 (78%) glutamate decarboxylase 3 | chr2:469505-471997 REVERSE LENGTH=500

Transcript Sequence (650 bp)

>PGSC0003DMT400003250 650 pgsc_dm_v3.4
ATACTTTTGTAATTAAATTGCAGGGATATCGAAATGTAATGGAAAATTGTCGTGAAAACG
CAATTATGTTAAGAGAAGGACTTGAAAAAACAGGACGTTTCAACATAGTCTCTAAAGATG
AAGGTGTCCCATTGGTGGCATTTTCCCTCAAGGACAATAGTCTTCACAATGAATTCGAGG
TCTCCGAGACGCTCCGTAGGTTCGGGTGGATTGTCCCGGCCTACACTATGCCAGCTGACG
CACAACACGTCACAGTGTTGCGCGTCGTGATCAGGGAGGACTTCTCCCGGACCCTGGCAG
AGCGTCTCGTCTTTGACATCGTCAAAGTCCTGCACGAGCTCGACACACTTCCGGCTAGGT
TGAGTGCCAAAATGGAGGAGGTTGGGGAGGAGAATTTGGTGATCAAGAACAATGGAAAGA
AAACAGAAATTGAAGTTCAAAGGGAAGTTACTGATTTTTGGAAGAAGTTTGTTTTAGCTA
GGAAAGCAGCTGTTTGCTAGGAAAGGATTAATTGTTGAAGGAATAAGTATTAGTAGTAAC
TTTTTATTATTAATTACAAAAAATATGATTTTTCTTTTAGATTATCTTGATGAGTAACTA
ACAAAATTTTATGAAGGATGATAGGTGTATCATCTTTTCTACTATTGACC