Microarray Probes on PGSC0003DMT400002220

Probe IDChipProbe Sequence
CUST_47071_PI426222305 JHI_St_60k_v1 GTTTCTTTATTTGCAATGGTGTTGGGTTTACCAATGCTCCATTTATTTTATGTGTTCTCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400002220

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400002220 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G35160.1 +1 1e-60 204 128/362 (35%) O-methyltransferase family protein | chr4:16730989-16732808 REVERSE LENGTH=382

Transcript Sequence (1232 bp)

>PGSC0003DMT400002220 1232 pgsc_dm_v3.4
AAATTGTCTAAATTCTCATTTTAGTTCTACAAATAAGTAAGTTTCTAAGAAATGTCATCA
AGTGAGAGTACTTCCACCGAGCTTCTTCACGCTCAAGCTCAAATTTGGAATTATATTTTC
AACTTTGTAAGTTCTTCAGCGGTAAAATGTGCACTTCAATTAGAAATTCCTGATGTCCTC
TACAAACATGAAAAGCCCATGTGTCTTTCTGATCTTTCTGCTGAATTGTCTGTCGTCAAT
TCTTCAAAGATTTCCTTCTTGCCAATTTTAATGCGCTTTCTTGTGCAATCTGGTTTCCTA
AATCAACATGAAGATCACTACTTTCTTACCCCAGCTAGTCGTCTTCTAGTGAAAAATGAG
TCGTTCAATGTTAGGTCATTCTTGCTTCTTAGCCATAGTCAAGCCTTTTCAAAAGCATGG
TCTGAGTTAAGTGATTGGTTTCAAAATGATTCTCCCACGCCTTTTCATACAGCTCATGGA
AAATCTGTATGGGATTACATTGGGGAAGAACAACCTAGTGTACTAGGTGATATTTTCAAC
GATGCATTGGCTAGCGACTCGAGGTTGAATACCAATATACTTATAACAGAGTGTAAACAT
GTGTTTGAGGGGTTAACATCGTTGGTAGACGTTGGTGGTGGCACTGGTACTGTTTCTATA
GCCATAGCCAAAGCTTTTCCTAACATAAAGTGCACAGTACTTGATCTCCCTCAAGTTATA
GGTTACCTAAAAGGAAGTGGGAATTTGGACTTCATTGGAGGAGATATGTTCGATAAGATT
CCTCAGGCTAATGCCATCTTACTCAAGTGTGTTCTACACGACTGGAATGATGAAGATTGT
GTGAAGATACTGAAGAAATGCAGAGAGTCAATTCCAAGCAAGGAAGAAGGAGGGAAAGTA
ATAATCATAGATACCGTTCTGGAGGATCCAAAACAGAGAAATGAGTTTGTTCGAGCACAA
CATAATATGGATATGTTGATGATGGTTCTCTTTGGTTCCAAAGAGAGAACTAAGAAAGAG
TGGGAGAAGTTGTTCATTGAAGTTGGTTTCAATGAATATAAAATAATCCCCGCTCTAGGT
TTAAGGTCTCTTATTGAAATTTACCCTTAAATTGAAAATGCATGTAAATTTACAGTGTTG
TCATGTTTCTTTATTTGCAATGGTGTTGGGTTTACCAATGCTCCATTTATTTTATGTGTT
CTCGTTTTATTATATTATTAGATGAATAATTT