Microarray Probes on PGSC0003DMT400000226

Probe IDChipProbe Sequence
CUST_3329_PI426222305 JHI_St_60k_v1 TACTGTGAATATTACTAGCCAGTCAATTCAAGATCAGAAGTGTACCAAAAAGGTTAAGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000226

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000226 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G46150.1 +2 5e-64 204 112/224 (50%) Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family | chr2:18961424-18962089 FORWARD LENGTH=221

Transcript Sequence (876 bp)

>PGSC0003DMT400000226 876 pgsc_dm_v3.4
AGTTAACACAAACTCAAACACCAAAGTCCCAAAATTTTTACATCTCAAATAGTACAACCA
TTTCTCCTCTTAGTTTCAAGACTCAATAAAAATGGTGGAGAGAGATCAAGTTAGACCACT
AGCTCCAGCATCCGACCAGCCACATAGCAGCGACGAAGATGAAACAATCAAAAAAAGGTT
TCATCAAAGAAGATGTTTCAAATATTGTGTTTGTGTATCAACCTTTCTTTTCCTTCTAGC
CATAATAATCATCATTTTGATCTTCACAGTGTTCAAAATAAAAGACCCTATTATTACAAT
GAACGGTGTCACAGTTGAAAAACTAGACCTCGTTAACACTAGTGGCACCCTTTTACCTAT
ACCTAAACCAGGTTCCAACATGACCATAAAAGCTGATGTCTCAGTGAAAAATCCTAATTA
TTCATCATTTAGGTATAGTAACACGACCACCACTATTTCCTATCGCGATACGGTGGTCGG
GGAGGCGCGGGGCCCACCGGGGAAATCGAAGGCACGGAAGACTATGAGGATGAACGTAAC
GATTGATATTATTACGGACAAAATTGTGTCACATCCTGGCTTACAAGATGATATTAGTAG
TGGTTTGCTTACTATGAATAGCTACACAAGTGTTGGTGGGAGAGTCAAATTGTTGAATAT
GATCAAGAAATATGTTGTTGTGAAGATGAATTGTAGTATTACTGTGAATATTACTAGCCA
GTCAATTCAAGATCAGAAGTGTACCAAAAAGGTTAAGCTTTAGATTGATATATATTACTA
GTAGTTAATTTTTGTCATGATATTTATTTTTTGCTACTACATCTTTAGTTTTGAGTTTTG
TATACTTCTTGTTGTTCATTATAAAATGAGTTTTTT