barSeed
Links

Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_41604_PI390587928Hv_44K_v2GTGTTAGAGTAAAACGAGATTGAATGAAAGTAATGGACGATCAGTCCTGATTTCTATTGA16GeneList: None
MasterList: None



Probe Values

This probe has no recorded values for this experiment





Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCAK37089510512e-24825 - 88410060 / 60plus ABC24951
MLOCAK36130113412e-241265 - 132410060 / 60plus ABC04383
MLOCMLOC_30054.12792e-24188 - 24710060 / 60plus None
MLOCMLOC_43295.15876e-2454 - 11210059 / 59minus None
MLOCMLOC_76197.115227e-231247 - 13069859 / 60plus ABC24951
MLOCMLOC_75936.111857e-231005 - 10649859 / 60plus None
MLOCAK3551578223e-22764 - 8229858 / 59plus None
MLOCMLOC_26399.110543e-22760 - 8189858 / 59plus None
MLOCMLOC_26399.310393e-22826 - 8849858 / 59plus None
MLOCMLOC_26399.29443e-22722 - 7809858 / 59plus None
MLOCMLOC_75747.29783e-21794 - 8539758 / 60plus None
MLOCMLOC_78393.19683e-2184 - 1449759 / 61minus ABC24951
MLOCMLOC_75748.234683e-211090 - 11499758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.128793e-211090 - 11499758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.1536043e-21852 - 9119758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.634223e-211023 - 10829758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.530013e-211023 - 10829758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.734943e-211023 - 10829758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.831403e-211023 - 10829758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.1728033e-21850 - 9099758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.1126493e-21858 - 9179758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.431293e-211090 - 11499758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.1231103e-21857 - 9169758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.1635753e-21852 - 9119758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.1434273e-21857 - 9169758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.924613e-21898 - 9579758 / 60plus ABC14726 ABC47837
MLOCMLOC_75748.1026443e-21898 - 9579758 / 60plus ABC14726 ABC47837
MLOCMLOC_42027.12503e-211 - 619759 / 61minus None
MLOCMLOC_10821.14423e-21117 - 1769759 / 61plus ABC01836 ABC24951 ABC41300
JLOC1JLOC1_39218.117051e-221540 - 15989858 / 59plus
JLOC1JLOC1_17929.29051e-22685 - 7439858 / 59plus
JLOC1JLOC1_17929.19351e-22715 - 7739858 / 59plus
JLOC1JLOC1_52246.16212e-2124 - 849759 / 61minus
JLOC1JLOC1_50526.1625912e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.1134232e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.1030662e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.831102e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.730752e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.634142e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.528082e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.428172e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.334002e-21948 - 10079758 / 60plus
JLOC1JLOC1_50526.124602e-21948 - 10079758 / 60plus
JLOC1JLOC1_50527.137002e-212694 - 27539758 / 60minus
JLOC1JLOC1_7109.14032e-21116 - 1759759 / 61plus
Harvest21ABC311854415e-23368 - 4269858 / 59plusABC31185
Harvest21ABC413003158e-2128 - 859757 / 59minusABC41300
Harvest35U35_491564043e-2517 - 7610060 / 60minus
Harvest35U35_310434415e-23368 - 4269858 / 59plus
Harvest35U35_331612706e-22214 - 2709856 / 57plus



Contig Sequence (404 bp)

>U35_49156 404 Hv_44K_v2
TTTTTTTTTTTTTTTTTCAATAGAAATCAGGACTGATCGTCCATTACTTTCATTCAATCT
CGTTTTACTCTAACACGTTATCACGCACGGTCTCGATTAGAGAAATAGGCCACGCCGAAA
GAATGGTGGCAGATGCACTCGCGCATCGCAACGAATCACCGACGACGAACTCGAACATTT
GTCGTCGATGCGGCGCCAAGGCCACGACCCACGGTCGGCCCACCGCAGCTACGCCCTCCG
GCACGCGCGTGGCGACCTCCTCGTTTCAGCGCCGCTCGGAAACAGGAGGCAGCGGCACGT
CGGCGGTGCAGCGATGGTCCCTCCGGCCCACGCCTGGTGCACAGCGCCCTTCGGCTTGGC
TCCTCCGGCGCTGCAGCATATCTGGTGTGACGCCCTCCAGCCAA



Homology of Contig U35_49156 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None