barSeed - Barley Seed Development Database

Probe CUST_26760_PI390587928

Source Contig U35_41002

barSeed

Links

Probe Details

Probe ID	Chip	Probe Sequence (60 bp)	Probe location	Differentially Expressed
CUST_26760_PI390587928	Hv_44K_v2	GCTTGCTGATTTTCTTGATGTCACAAAAGATGAGAAGCTTATTATGCATATGTGGAATTC	591	GeneList: None MasterList: None

Probe Values

This probe has no recorded values for this experiment

Probe Sequence's BLAST hits in Barley Unigene Datasets

Dataset	Hit	Hit Length	E-value	Position on Hit	% Identity	Match	Direction	Probes on Sequence
MLOC	AK250065.1	1961	2e-24	1124 - 1183	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.24	1719	2e-24	1066 - 1125	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.18	2423	2e-24	1649 - 1708	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.13	3107	2e-24	2454 - 2513	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.2	3188	2e-24	2620 - 2679	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.3	2613	2e-24	1924 - 1983	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.4	2557	2e-24	1868 - 1927	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.21	2851	2e-24	2205 - 2264	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.19	3116	2e-24	2470 - 2529	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.17	2565	2e-24	1919 - 1978	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.1	5006	2e-24	4360 - 4419	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.23	2179	2e-24	1357 - 1416	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.15	3360	2e-24	2538 - 2597	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.16	3300	2e-24	2681 - 2740	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.10	2480	2e-24	1930 - 1989	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.11	3176	2e-24	2626 - 2685	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.12	2424	2e-24	1874 - 1933	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.5	2707	2e-24	1880 - 1939	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.6	2740	2e-24	1913 - 1972	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.7	2809	2e-24	1982 - 2041	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.25	2562	2e-24	1682 - 1741	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.8	2514	2e-24	1634 - 1693	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.9	2693	2e-24	1813 - 1872	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.20	1998	2e-24	1154 - 1213	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.14	2553	2e-24	1709 - 1768	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
JLOC1	JLOC1_42122.23	846	8e-25	96 - 155	100	60 / 60	plus
JLOC1	JLOC1_42122.22	2510	8e-25	1811 - 1870	100	60 / 60	plus
JLOC1	JLOC1_42122.21	2565	8e-25	1733 - 1792	100	60 / 60	plus
JLOC1	JLOC1_42122.20	2621	8e-25	1668 - 1727	100	60 / 60	plus
JLOC1	JLOC1_42122.19	2708	8e-25	1876 - 1935	100	60 / 60	plus
JLOC1	JLOC1_42122.18	2723	8e-25	1770 - 1829	100	60 / 60	plus
JLOC1	JLOC1_42122.17	3552	8e-25	2853 - 2912	100	60 / 60	plus
JLOC1	JLOC1_42122.16	2507	8e-25	1554 - 1613	100	60 / 60	plus
JLOC1	JLOC1_42122.15	2989	8e-25	2157 - 2216	100	60 / 60	plus
JLOC1	JLOC1_42122.14	2575	8e-25	1876 - 1935	100	60 / 60	plus
JLOC1	JLOC1_42122.13	3685	8e-25	2853 - 2912	100	60 / 60	plus
JLOC1	JLOC1_42122.12	3861	8e-25	3029 - 3088	100	60 / 60	plus
JLOC1	JLOC1_42122.11	3337	8e-25	2587 - 2646	100	60 / 60	plus
JLOC1	JLOC1_42122.10	2916	8e-25	2084 - 2143	100	60 / 60	plus
JLOC1	JLOC1_42122.9	2907	8e-25	2157 - 2216	100	60 / 60	plus
JLOC1	JLOC1_42122.8	3322	8e-25	2572 - 2631	100	60 / 60	plus
JLOC1	JLOC1_42122.7	2841	8e-25	2142 - 2201	100	60 / 60	plus
JLOC1	JLOC1_42122.6	3419	8e-25	2587 - 2646	100	60 / 60	plus
JLOC1	JLOC1_42122.5	3764	8e-25	2811 - 2870	100	60 / 60	plus
JLOC1	JLOC1_42122.4	2495	8e-25	1796 - 1855	100	60 / 60	plus
JLOC1	JLOC1_42122.3	3860	8e-25	3161 - 3220	100	60 / 60	plus
JLOC1	JLOC1_42122.2	3011	8e-25	2179 - 2238	100	60 / 60	plus
JLOC1	JLOC1_42122.1	3441	8e-25	2609 - 2668	100	60 / 60	plus
Harvest35	U35_41002	656	3e-25	592 - 651	100	60 / 60	plus

Contig Sequence (656 bp)

>U35_41002 656 Hv_44K_v2
CTCTTGTCTTCACTGTCAGCTTCTCTCGAGTTAAATTCAAATTCTATATAAATACCGGAC
TATGCCAATTTTGCTAGCATGATATCTGAATTATTTGTGTTCAGTTGCAACTAGCAGGTG
GCAAATCAAATACAGTTTTCTGCCTAGTTTTCAGTTGTGCCCCATATACCAGCCAGTTTT
ATGGGCATGGTTTAATATTGGAGGGTGATCCAGTAAGCAAAGGTGTTTGCTTGCATGACT
TGCCGGCGTGAAAGAAAATTCAGCTTTCTTGTTCTGTGATATGATACCATTGGGCACTCT
TTCATCGTTATTCAGCTTATTTTTCTTGCAGATGCTCATTATTTAGGTCCCTACTAAAGC
TTTGTTTTATTAGATTCTTTGATATTACTTTGGGTTTTTATGCCTGCATTTGATATCTGG
CATGATGTCTGAATTTCAGTCACTCTTGTTTCTATAACGGACAGTTTTATGCCTGCATTT
GACATGTATAGCTTGATTGTTGTAGCCAATAGCAGTGGAACAAGTTTTCTCAGATCATGA
CAGCGAGGATGAAGTGGACGATGACATTGCCGACTTCGAAGATAGACGGATGCTTGCTGA
TTTTCTTGATGTCACAAAAGATGAGAAGCTTATTATGCATATGTGGAATTCATTTA

Homology of Contig U35_41002 to Model Species (E-value threshold 1e-50)

Pseudo-peptide dataset	Hit	Hit length	E-value	Description
Rice v7	None
Brachypodium v1_2	None
Arabidopsis v10	None