barSeed - Barley Seed Development Database

Probe CUST_25617_PI390587928

Source Contig U35_29254

barSeed

Links

Probe Details

Probe ID	Chip	Probe Sequence (60 bp)	Probe location	Differentially Expressed
CUST_25617_PI390587928	Hv_44K_v2	GTGAATTTGCTAGCACCAAAGCCACATTCATGATTCCAGACGTCAAGAATATGGCAACCT	457	GeneList: None MasterList: None

Probe Values

This probe has no recorded values for this experiment

Probe Sequence's BLAST hits in Barley Unigene Datasets

Dataset	Hit	Hit Length	E-value	Position on Hit	% Identity	Match	Direction	Probes on Sequence
MLOC	AK250065.1	1961	2e-24	132 - 191	100	60 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.18	2423	7e-23	197 - 256	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.13	3107	7e-23	540 - 599	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.2	3188	7e-23	610 - 669	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.3	2613	7e-23	610 - 669	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.4	2557	7e-23	610 - 669	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.19	3116	7e-23	179 - 238	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.17	2565	7e-23	477 - 536	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.1	5006	7e-23	1070 - 1129	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.15	3360	7e-23	528 - 587	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.16	3300	7e-23	528 - 587	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.10	2480	7e-23	548 - 607	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.11	3176	7e-23	548 - 607	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.12	2424	7e-23	548 - 607	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.5	2707	7e-23	581 - 640	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.6	2740	7e-23	581 - 640	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.7	2809	7e-23	581 - 640	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.8	2514	7e-23	574 - 633	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.9	2693	7e-23	574 - 633	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
MLOC	MLOC_64195.14	2553	7e-23	538 - 597	98	59 / 60	plus	ABC13445 ABC20884 ABC39307
JLOC1	JLOC1_42122.22	2510	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.21	2565	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.20	2621	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.19	2708	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.18	2723	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.17	3552	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.16	2507	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.15	2989	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.14	2575	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.13	3685	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.12	3861	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.11	3337	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.10	2916	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.9	2907	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.8	3322	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.7	2841	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.6	3419	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.5	3764	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.4	2495	4e-23	562 - 621	98	59 / 60	plus
JLOC1	JLOC1_42122.3	3860	4e-23	727 - 786	98	59 / 60	plus
JLOC1	JLOC1_42122.2	3011	4e-23	727 - 786	98	59 / 60	plus
JLOC1	JLOC1_42122.1	3441	4e-23	727 - 786	98	59 / 60	plus
Harvest21	ABC28492	594	3e-25	458 - 517	100	60 / 60	plus
Harvest35	U35_29254	594	3e-25	458 - 517	100	60 / 60	plus

Contig Sequence (594 bp)

>U35_29254 594 Hv_44K_v2
GCGAAGCCGAAATCCCTAACGCCGGCGCCGGCGCCCTTGTCCGTTCACCATCGCGCGCCC
GTCCCATAGCTTGGATTTCGATTTCGATTTAGGGCAAGGGCAAGGGCAGACCACATGTGC
CGCCAACCGTCCACGCCTGACTTGTCTCCAGATGAGCAGCTTGCTGCCGAAGAAACCTTC
AAGTTGTACTGCAAGCCAGTTGAGCTCTGCAATGTTATTCAAAAACGAGCCCTTGATAAT
CCCGCTTTCCTGCAAAGATGCCTTCATTACATGATACAGGCAAGCCGTAAAAAGAGGATT
CAACTAACCGTATCCCTTTCTCGAGGTATCGAATGCCCAGACCAGAATATCTTCCCCCTT
TATCTTCTCTTAGCTACACCTACTAGTGATAACATCCCACTTGAAGGGCATTCTCCTATA
TATCGATTCAGCCGTGCCTGTTTGCTTACGTCATTCAGTGAATTTGCTAGCACCAAAGCC
ACATTCATGATTCCAGACGTCAAGAATATGGCAACCTCCCGAGCTTGCAACCTCAGCGTT
ATCCTTATCCGCTGTGCTTCACAAGGGCAAGCTGGAGAAAATAACTGCTCCGGG

Homology of Contig U35_29254 to Model Species (E-value threshold 1e-50)

Pseudo-peptide dataset	Hit	Hit length	E-value	Description
Rice v7	LOC_Os09g13630.1	605	4e-62	protein\|ZOS9-03 - C2H2 zinc finger protein, expressed
Brachypodium v1_2	Bradi3g03106.1	647	8e-70
Arabidopsis v10	None