barSeed - Barley Seed Development Database

Probe CUST_12375_PI390587928

Source Contig U35_47051

barSeed

Links

Probe Details

Probe ID	Chip	Probe Sequence (60 bp)	Probe location	Differentially Expressed
CUST_12375_PI390587928	Hv_44K_v2	CCGCTTTTGAACTTTTTGGTTTAAAATTCAGATCTCTCGAGTTCAGTAAAATTCAGTGGT	84	GeneList: None MasterList: None

Probe Values

This probe has no recorded values for this experiment

Probe Sequence's BLAST hits in Barley Unigene Datasets

Dataset	Hit	Hit Length	E-value	Position on Hit	% Identity	Match	Direction	Probes on Sequence
MLOC	MLOC_75748.2	3468	2e-24	2549 - 2608	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.15	3604	2e-24	2479 - 2538	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.6	3422	2e-24	2297 - 2356	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.5	3001	2e-24	2482 - 2541	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.8	3140	2e-24	2621 - 2680	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.17	2803	2e-24	2318 - 2377	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.4	3129	2e-24	2210 - 2269	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.12	3110	2e-24	2614 - 2673	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.16	3575	2e-24	2450 - 2509	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75748.14	3427	2e-24	2325 - 2384	100	60 / 60	plus	ABC14726 ABC47837
MLOC	MLOC_75747.1	2150	2e-23	1818 - 1875	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75748.1	2879	2e-23	2688 - 2745	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75748.3	1916	2e-23	1725 - 1782	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75748.7	3494	2e-23	2491 - 2548	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75747.3	1229	2e-23	897 - 954	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75748.11	2649	2e-23	2317 - 2374	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75748.13	1518	2e-23	1144 - 1201	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75748.9	2461	2e-23	2168 - 2225	100	58 / 58	plus	ABC14726 ABC47837
MLOC	MLOC_75748.10	2644	2e-23	2351 - 2408	100	58 / 58	plus	ABC14726 ABC47837
JLOC1	JLOC1_50526.16	2591	8e-25	2068 - 2127	100	60 / 60	plus
JLOC1	JLOC1_50526.14	2399	8e-25	1270 - 1329	100	60 / 60	plus
JLOC1	JLOC1_50526.12	2097	8e-25	1574 - 1633	100	60 / 60	plus
JLOC1	JLOC1_50526.3	3400	8e-25	2271 - 2330	100	60 / 60	plus
JLOC1	JLOC1_50527.1	3700	8e-25	1067 - 1126	100	60 / 60	minus
JLOC1	JLOC1_50526.15	1636	1e-23	1235 - 1292	100	58 / 58	plus
JLOC1	JLOC1_50526.13	3125	1e-23	2118 - 2175	100	58 / 58	plus
JLOC1	JLOC1_50526.11	3423	1e-23	2416 - 2473	100	58 / 58	plus
JLOC1	JLOC1_50526.10	3066	1e-23	2059 - 2116	100	58 / 58	plus
JLOC1	JLOC1_50526.9	2590	1e-23	1583 - 1640	100	58 / 58	plus
JLOC1	JLOC1_50526.8	3110	1e-23	2103 - 2160	100	58 / 58	plus
JLOC1	JLOC1_50526.7	3075	1e-23	2068 - 2125	100	58 / 58	plus
JLOC1	JLOC1_50526.6	3414	1e-23	2407 - 2464	100	58 / 58	plus
JLOC1	JLOC1_50526.5	2808	1e-23	2407 - 2464	100	58 / 58	plus
JLOC1	JLOC1_50526.4	2817	1e-23	2416 - 2473	100	58 / 58	plus
JLOC1	JLOC1_50526.2	1627	1e-23	1226 - 1283	100	58 / 58	plus
JLOC1	JLOC1_50526.1	2460	1e-23	2059 - 2116	100	58 / 58	plus
JLOC1	JLOC1_52039.1	1365	6e-21	1145 - 1203	97	58 / 60	plus
Harvest21	ABC50649	581	3e-25	173 - 232	100	60 / 60	minus
Harvest21	ABC47837	557	3e-25	85 - 144	100	60 / 60	minus	ABC47837
Harvest35	U35_48671	581	3e-25	173 - 232	100	60 / 60	minus
Harvest35	U35_47051	557	3e-25	85 - 144	100	60 / 60	minus

Contig Sequence (557 bp)

>U35_47051 557 Hv_44K_v2
TTTTTTTTTTTTTTTTTCTGAACTAACTGATTTTTTTCCAACAAAGATTTATACTAAAAA
ATTGTACATCGTATGACTTTCTTTACCACTGAATTTTACTGAACTCGAGAGATCTGAATT
TTAAACCAAAAAGTTCAAAAGCGGGGATCTCTGCCAATGGGGACGTGCATACTCCCCTGC
ACCTTACATCACATATTGAATGGCTTTAAATATTTGCAAGCACCGCCAGCACAGGGATTT
CCATGCAGCTTGTGCGATCTATAATCTGGCCACTGTGATTCCACTCAAGGAGAGTGATGC
TCCCAGATTCCACCGTGTGCAACAAATCTGGAAAAACTCGACGTAAGCATTAGGCCATTG
GACCGTGTTGTAAGCAACCGGTCCATCCATCCGGCAATACAGCTACAGGGCAGACTGGCT
GCAACCTCTAGGCCTACTATGTATGGTAGAGAACAACCGATTCTTAGGCTTTTCATGACG
CCCTGAGCTGATGTGGTCTTACTGCTGGGGCAAACTCACCGTAATTTCCTGCTACTTGCG
ATGCTATGCTTGATGGC

Homology of Contig U35_47051 to Model Species (E-value threshold 1e-50)

Pseudo-peptide dataset	Hit	Hit length	E-value	Description
Rice v7	None
Brachypodium v1_2	None
Arabidopsis v10	None