- Primer Hv87
Location of Primer Pair Hv87
Primer Pair Details
Gene Name | HvLol1 |
---|---|
Gene Description | protein with 3 plant-specific zinc finger domains, act as a positive regulator of cell death. LOL1; lsd one like 1 |
Chromosome | chr1H |
Forward Primer Start | 501619406 |
Forward Primer End | 501619426 |
Reverse Primer Start | 501619038 |
Reverse Primer End | 501619058 |
Forward Primer Sequence | CTGAACCGGGCAAGCGCGAGCC |
Reverse Primer Sequence | CCTGAGCCGGCGTCGTCGTTGC |