- Primer Hv87
Location of Primer Pair Hv87

Primer Pair Details
| Gene Name | HvLol1 |
|---|---|
| Gene Description | protein with 3 plant-specific zinc finger domains, act as a positive regulator of cell death. LOL1; lsd one like 1 |
| Chromosome | chr1H |
| Forward Primer Start | 501619406 |
| Forward Primer End | 501619426 |
| Reverse Primer Start | 501619038 |
| Reverse Primer End | 501619058 |
| Forward Primer Sequence | CTGAACCGGGCAAGCGCGAGCC |
| Reverse Primer Sequence | CCTGAGCCGGCGTCGTCGTTGC |