- Primer Hv64
Location of Primer Pair Hv64

Primer Pair Details
| Gene Name | HvCul |
|---|---|
| Gene Description | Cullin, component of SCF ubiquitin ligase complexes; response to auxin and jasmonic acid |
| Chromosome | chr3H |
| Forward Primer Start | 659169857 |
| Forward Primer End | 659169877 |
| Reverse Primer Start | 659171296 |
| Reverse Primer End | 659171316 |
| Forward Primer Sequence | CCGTCGGCTGCCCTCCTCACC |
| Reverse Primer Sequence | CATTTTTACTGCTTTGCTCC |