- Primer Hv197
Location of Primer Pair Hv197

Primer Pair Details
| Gene Name | HvIPM |
|---|---|
| Gene Description | interacts with PIEPPPHH; required for both leaf adaxial?abaxial polarity formation |
| Chromosome | chr2H |
| Forward Primer Start | 698441676 |
| Forward Primer End | 698441696 |
| Reverse Primer Start | 698442010 |
| Reverse Primer End | 698442030 |
| Forward Primer Sequence | GGGCCGAGGCCTAGCAGCGG |
| Reverse Primer Sequence | GTCTTCTGGTGCCTGACGGG |