- Primer Hv131
Location of Primer Pair Hv131

Primer Pair Details
| Gene Name | Hv26Si |
|---|---|
| Gene Description | non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
| Chromosome | chr4H |
| Forward Primer Start | 534646079 |
| Forward Primer End | 534646099 |
| Reverse Primer Start | 534644969 |
| Reverse Primer End | 534644989 |
| Forward Primer Sequence | GGCGTCTGGTCAATCTGATATG |
| Reverse Primer Sequence | GTAAAAGCAGCTAATGCAGG |