JHI-Hv50k-2016-127

Locus Information
Data Item Value
Locus Name JHI-Hv50k-2016-127
Platform Barley 50K Platform
Genome Build Version 2016
Position 1H:72059
Source JHI_ExCapSeq
Source Version 0
Final Score 0.988
Failure Codes
Assay Design ID 2341823565
Illumina ID JHI-Hv50k-2016-127-0_T_U_2341823565
Normalization Bin C
Bead Types Assay 1
Design Date 03/03/2016
Assay Type InfiniumII
Sequence Information

Sequence Orientation UNKNOWN

AGAAAGGAAKAATGTATATTATACTCTACCACAATAACRGSCCCCTTGAAGAAACTGATG[T/C]TCTCTCTACTAGCAAAGCAACTTAGACAGAGCAATGCAATTTTCAAGTCTCAACTCTGAA

SNP Effects Data

INTRON(MODIFIER|||||HORVU1Hr1G000040|Hv_IBSC_PGSB_r1||HORVU1Hr1G000040.1|1|1|WARNING_TRANSCRIPT_INCOMPLETE),UTR_3_PRIME(MODIFIER||12|||HORVU1Hr1G000050|Hv_IBSC_PGSB_r1||HORVU1Hr1G000050.1|2|1|WARNING_TRANSCRIPT_NO_START_CODON),UTR_5_PRIME(MODIFIER||221|||HORVU1Hr1G000040|Hv_IBSC_PGSB_r1||HORVU1Hr1G000040.2|1|1),UTR_5_PRIME(MODIFIER||221|||HORVU1Hr1G000040|Hv_IBSC_PGSB_r1||HORVU1Hr1G000040.3|1|1)

Data Version 1.0 - Last updated 14th September 2016.
Germinate Barley SNP Platforms

© 2017 The James Hutton Institute Information and Computational Sciences Group / Cell and Molecular Sciences Group.

Paul Shaw, Micha Bayer, Pete Hedley, Joanne Russell, Luke Ramsay, Bill Thomas, Malcolm Macaulay, Paulo Flores and Robbie Waugh.

For further information please contact us barleysnpchip@hutton.ac.uk