Probe CUST_9394_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_9394_PI426222305 JHI_St_60k_v1 DMT400058893 TATCCCCCTGAGCAATGTGAGCATAGCTCTAGTAAATGTCTGGTCATAATATTTAAAAAA

All Microarray Probes Designed to Gene DMG400022885

Probe IDChip nameTranscript IDProbe Sequence
CUST_9196_PI426222305 JHI_St_60k_v1 DMT400058897 GATCCTCCTCTGGAAACTTCATGACGTGTATAGACAAATTTGGTTGATATTTGAAAAATC
CUST_9191_PI426222305 JHI_St_60k_v1 DMT400058896 GATCCTCCTCTGGAAACTTCATGACGTGTATAGACAAATTTGGTTGATATTTGAAAAATC
CUST_9394_PI426222305 JHI_St_60k_v1 DMT400058893 TATCCCCCTGAGCAATGTGAGCATAGCTCTAGTAAATGTCTGGTCATAATATTTAAAAAA
CUST_9475_PI426222305 JHI_St_60k_v1 DMT400058894 CTTCCAAAACTTATTACTGTTTTTCTTCACAAATCTTTTTCTGTGTGAAGCTTGTGCACG


Microarray Signals from CUST_9394_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h28.72034.36680.9625960.22447
ABA 1h91.665514.0783.463780.398863
ACC 1h29.64297.375650.9146440.352289
BABA 1h35.94637.632641.211440.173769
Chitin 1h29.68793.948761.116650.151051
Epi 1h17.61424.202440.6571110.170443
SA 1h34.10477.218011.091940.214161
Me-JA 1h16.27363.967540.6415050.172636
Control 6h28.86195.604250.9461490.147853
ABA 6h129.08628.79353.924060.844893
ACC 6h29.22987.684310.8219570.309558
BABA 6h24.08848.385280.6224910.295828
Chitin 6h35.16378.225721.058710.316167
Epi 6h25.81474.637910.7787640.142611
SA 6h32.550110.10541.029510.490337
Me-JA 6h33.75969.631461.056620.298241

Source Transcript PGSC0003DMT400058893 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G54100.1 +1 0.0 572 291/355 (82%) aldehyde dehydrogenase 7B4 | chr1:20195435-20198853 REVERSE LENGTH=508

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058893

Click here to view details at Spud DB Genome Browser (opens in new window)