Probe CUST_9393_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_9393_PI426222305 JHI_St_60k_v1 DMT400058933 GGTGGACTAGTGAGTCTTCTCTGCATATATGTAATATCAAGATGTATGTTTGTATCTACA

All Microarray Probes Designed to Gene DMG400022894

Probe IDChip nameTranscript IDProbe Sequence
CUST_9333_PI426222305 JHI_St_60k_v1 DMT400058934 GGTGGACTAGTGAGTCTTCTCTGCATATATGTAATATCAAGATGTATGTTTGTATCTACA
CUST_9393_PI426222305 JHI_St_60k_v1 DMT400058933 GGTGGACTAGTGAGTCTTCTCTGCATATATGTAATATCAAGATGTATGTTTGTATCTACA
CUST_9167_PI426222305 JHI_St_60k_v1 DMT400058932 GGTGGACTAGTGAGTCTTCTCTGCATATATGTAATATCAAGATGTATGTTTGTATCTACA


Microarray Signals from CUST_9393_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h23969.64153.051.608950.221654
ABA 1h20122.65841.871.44550.328269
ACC 1h23035.98528.761.313590.5211
BABA 1h26456.94910.041.825150.192556
Chitin 1h15436.42611.71.153620.155608
Epi 1h18975.13547.781.453410.297124
SA 1h32051.84251.372.119270.254361
Me-JA 1h42503.42518.253.585450.207006
Control 6h10238.52658.360.6546470.127624
ABA 6h8046.32823.6220.5173930.0298724
ACC 6h6757.78892.6220.4004860.023123
BABA 6h8190.04534.3780.5034110.0290652
Chitin 6h8355.62482.8290.5419630.031291
Epi 6h7494.4983.0440.4519210.0689784
SA 6h8435.86721.4080.5848310.033766
Me-JA 6h169041804.31.158810.0669045

Source Transcript PGSC0003DMT400058933 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G17420.1 +3 0.0 1285 648/876 (74%) lipoxygenase 3 | chr1:5977512-5981384 FORWARD LENGTH=919

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058933

Click here to view details at Spud DB Genome Browser (opens in new window)