Probe CUST_8668_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_8668_PI426222305 JHI_St_60k_v1 DMT400034348 GAACTTACTGGAACCATTAGAAAAGGACACGGTCAGCCTCAGTACTTAGATAAATTGCAG

All Microarray Probes Designed to Gene DMG400013207

Probe IDChip nameTranscript IDProbe Sequence
CUST_8658_PI426222305 JHI_St_60k_v1 DMT400034349 AACCGTATGATGTAACAACTTTGGTTGAAATTGGTAACGGCATTGATTCTTCATTCCGTC
CUST_8668_PI426222305 JHI_St_60k_v1 DMT400034348 GAACTTACTGGAACCATTAGAAAAGGACACGGTCAGCCTCAGTACTTAGATAAATTGCAG
CUST_8602_PI426222305 JHI_St_60k_v1 DMT400034344 GAACTTACTGGAACCATTAGAAAAGGACACGGTCAGCCTCAGTACTTAGATAAATTGCAG


Microarray Signals from CUST_8668_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h17.62813.218760.9875860.188141
ABA 1h22.92424.571441.424790.266116
ACC 1h10.39953.419630.5770.190384
BABA 1h17.07093.36780.9884370.272361
Chitin 1h5.220733.045410.3407160.192293
Epi 1h11.31643.194880.6759470.270746
SA 1h16.73465.535360.8440480.289958
Me-JA 1h12.77193.844680.7848310.359993
Control 6h30.743417.18191.301950.771137
ABA 6h31.155112.29991.274270.906565
ACC 6h23.26053.99711.155410.19337
BABA 6h28.792710.68781.189960.676079
Chitin 6h20.32783.638741.05220.222222
Epi 6h18.86586.736810.8167770.455372
SA 6h24.41445.489981.348940.482675
Me-JA 6h29.42826.77981.609730.234363

Source Transcript PGSC0003DMT400034348 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G39900.1 +3 0.0 890 452/555 (81%) Small GTP-binding protein | chr5:15976719-15978925 REVERSE LENGTH=663

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034348

Click here to view details at Spud DB Genome Browser (opens in new window)