Probe CUST_6392_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_6392_PI426222305 | JHI_St_60k_v1 | DMT400014291 | CGCCAAGGCTCTATGACAATTCTGCTGTACAAATTCAAATTGTCATTTGTAATTTTTCGT |
All Microarray Probes Designed to Gene DMG400005604
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_6392_PI426222305 | JHI_St_60k_v1 | DMT400014291 | CGCCAAGGCTCTATGACAATTCTGCTGTACAAATTCAAATTGTCATTTGTAATTTTTCGT |
Microarray Signals from CUST_6392_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 827.223 | 47.9287 | 0.936483 | 0.0542126 |
ABA 1h | 1250.69 | 138.057 | 1.58102 | 0.128355 |
ACC 1h | 833.21 | 108.647 | 0.903127 | 0.0557921 |
BABA 1h | 736.081 | 137.15 | 0.831875 | 0.0869095 |
Chitin 1h | 786.638 | 75.6851 | 0.981406 | 0.173154 |
Epi 1h | 765.434 | 44.3932 | 1.00067 | 0.0579617 |
SA 1h | 875.115 | 92.3583 | 0.955137 | 0.0586996 |
Me-JA 1h | 521.005 | 30.3531 | 0.721807 | 0.0419767 |
Control 6h | 1153.47 | 243.23 | 1.25138 | 0.215161 |
ABA 6h | 1967.78 | 269 | 2.05658 | 0.180164 |
ACC 6h | 1424.44 | 251.405 | 1.36693 | 0.0790391 |
BABA 6h | 1133.8 | 96.4877 | 1.13892 | 0.0658963 |
Chitin 6h | 1000.29 | 66.9836 | 1.05973 | 0.0613463 |
Epi 6h | 1114.78 | 70.3135 | 1.11596 | 0.0986868 |
SA 6h | 797.653 | 104.348 | 0.898045 | 0.0561324 |
Me-JA 6h | 413.239 | 76.9147 | 0.45114 | 0.0637581 |
Source Transcript PGSC0003DMT400014291 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G52342.1 | +1 | 9e-10 | 53 | 20/50 (40%) | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr1:19492440-19492703 REVERSE LENGTH=87 |