Probe CUST_6379_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_6379_PI426222305 JHI_St_60k_v1 DMT400014682 AGAAACAGATTTTGCAGAGCCAACTTGCCTTTGTCGGGACCGGACTTATTCCTATTACTG

All Microarray Probes Designed to Gene DMG402005729

Probe IDChip nameTranscript IDProbe Sequence
CUST_6379_PI426222305 JHI_St_60k_v1 DMT400014682 AGAAACAGATTTTGCAGAGCCAACTTGCCTTTGTCGGGACCGGACTTATTCCTATTACTG
CUST_6715_PI426222305 JHI_St_60k_v1 DMT400014679 TCTTTTGACTCTTACCCAGTAGGTGTTGAAGGTGGACTTTAGATGTTAATAAGACTTACA


Microarray Signals from CUST_6379_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h32.52794.053280.9032150.117451
ABA 1h22.80743.690920.710170.117641
ACC 1h35.046312.32330.7892810.368965
BABA 1h53.01198.662651.501250.144367
Chitin 1h29.43363.954750.9042750.125126
Epi 1h28.62054.055860.9257160.134399
SA 1h78.46618.02692.045640.490486
Me-JA 1h70.41536.419612.404640.203006
Control 6h37.201514.370.7998740.479236
ABA 6h50.049616.93041.119780.518492
ACC 6h35.115211.7970.7276630.291074
BABA 6h74.549724.16231.691870.496793
Chitin 6h32.6338.441190.8097690.228524
Epi 6h22.70199.850580.4416820.256332
SA 6h40.908626.6670.7532330.940277
Me-JA 6h38.41412.34870.9707260.258364

Source Transcript PGSC0003DMT400014682 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G18390.2 +2 2e-168 506 298/626 (48%) Protein kinase superfamily protein | chr1:6327463-6329935 FORWARD LENGTH=654

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400014682

Click here to view details at Spud DB Genome Browser (opens in new window)