Probe CUST_52215_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_52215_PI426222305 JHI_St_60k_v1 DMT400075156 ATGAAGGCTGAATCGGAACCGGAAAAGGCACAGATGACGATATTCTATGCAGATTTACCA

All Microarray Probes Designed to Gene DMG400029237

Probe IDChip nameTranscript IDProbe Sequence
CUST_52215_PI426222305 JHI_St_60k_v1 DMT400075156 ATGAAGGCTGAATCGGAACCGGAAAAGGCACAGATGACGATATTCTATGCAGATTTACCA
CUST_52218_PI426222305 JHI_St_60k_v1 DMT400075153 GGTTGTTCAATTCATCATCTCTCAAGTTTTCATGTGTTCGCAACAACAATTTATCTGTCT
CUST_52217_PI426222305 JHI_St_60k_v1 DMT400075155 GGTTGTTCAATTCATCATCTCTCAAGTTTTCATGTGTTCGCAACAACAATTTATCTGTCT
CUST_52214_PI426222305 JHI_St_60k_v1 DMT400075154 CAGCCAATTGTTTCTGGTAATAGTTTTCCCCTTTTGAGTGTCTGTCTGTTCTTCCTTGTT


Microarray Signals from CUST_52215_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h4964.94940.8261.245740.173841
ABA 1h3817.461255.711.006670.269227
ACC 1h7135.432297.891.582040.529846
BABA 1h6172.48799.8781.630970.0941678
Chitin 1h3800.28220.1581.092840.0631006
Epi 1h4353.69308.3641.298360.074966
SA 1h8089.691241.031.997530.28165
Me-JA 1h15413.61468.064.856890.280414
Control 6h3551.941034.170.8384410.19163
ABA 6h1660.42142.9520.4020770.038665
ACC 6h2677.5472.1940.5881860.038594
BABA 6h3405.97375.2250.7805150.060076
Chitin 6h2904.23167.9880.7067830.0408141
Epi 6h3301.08522.5360.7398670.164132
SA 6h2640.21307.9190.6824640.0394115
Me-JA 6h8433.26935.2982.168230.133677

Source Transcript PGSC0003DMT400075156 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G19180.1 +3 1e-08 54 48/129 (37%) jasmonate-zim-domain protein 1 | chr1:6622312-6623271 FORWARD LENGTH=253

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400075156

Click here to view details at Spud DB Genome Browser (opens in new window)