Probe CUST_51424_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_51424_PI426222305 | JHI_St_60k_v1 | DMT400034022 | GATTACATTGGGTATGTTGTTGTTGTTGTTGTAATACTTTGTAGGTCTATCGGAAACAAC |
All Microarray Probes Designed to Gene DMG400013077
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_51424_PI426222305 | JHI_St_60k_v1 | DMT400034022 | GATTACATTGGGTATGTTGTTGTTGTTGTTGTAATACTTTGTAGGTCTATCGGAAACAAC |
Microarray Signals from CUST_51424_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 474.614 | 80.6377 | 1.03332 | 0.10748 |
ABA 1h | 457.922 | 30.1395 | 1.15254 | 0.135194 |
ACC 1h | 524.837 | 105.846 | 1.08888 | 0.170102 |
BABA 1h | 255.788 | 41.503 | 0.576922 | 0.0475966 |
Chitin 1h | 195.524 | 23.4494 | 0.478547 | 0.0322104 |
Epi 1h | 282.982 | 16.7518 | 0.729698 | 0.0431216 |
SA 1h | 721.62 | 95.1386 | 1.54226 | 0.167022 |
Me-JA 1h | 368.166 | 70.2779 | 0.973451 | 0.0986834 |
Control 6h | 644.456 | 86.0688 | 1.41053 | 0.0968572 |
ABA 6h | 379.36 | 38.6563 | 0.789048 | 0.0853688 |
ACC 6h | 567.304 | 33.0923 | 1.10442 | 0.125958 |
BABA 6h | 528.002 | 30.7845 | 1.05467 | 0.0614916 |
Chitin 6h | 473.072 | 27.7363 | 0.990413 | 0.0578889 |
Epi 6h | 494.628 | 52.9413 | 0.969951 | 0.181229 |
SA 6h | 973.943 | 290.753 | 1.94111 | 0.542253 |
Me-JA 6h | 501.525 | 71.542 | 1.10129 | 0.185861 |
Source Transcript PGSC0003DMT400034022 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT5G12890.1 | +2 | 5e-100 | 317 | 193/495 (39%) | UDP-Glycosyltransferase superfamily protein | chr5:4069658-4071124 REVERSE LENGTH=488 |