Probe CUST_50107_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_50107_PI426222305 JHI_St_60k_v1 DMT400065178 TCCTACCGTGTATTCTCTATTTGAAGGTTAAAAGTGTCTTGACTTTGTAATTGAGATGCA

All Microarray Probes Designed to Gene DMG400025331

Probe IDChip nameTranscript IDProbe Sequence
CUST_50130_PI426222305 JHI_St_60k_v1 DMT400065176 CTCTATTTGAAGGTTAAAAGTGTCTTGACTTTGTAATTGAGATGCATTGTGTGAGCTATG
CUST_50107_PI426222305 JHI_St_60k_v1 DMT400065178 TCCTACCGTGTATTCTCTATTTGAAGGTTAAAAGTGTCTTGACTTTGTAATTGAGATGCA
CUST_50117_PI426222305 JHI_St_60k_v1 DMT400065175 AATATGGTCAACTCGACATAATGTTCAGTAACGCAGGAGTCGTTGGCCCTTTAGCTCATC


Microarray Signals from CUST_50107_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h2171.89222.8421.342990.0775634
ABA 1h1490.5986.34991.049670.0606413
ACC 1h2016.41275.1651.201640.080832
BABA 1h1445.34178.0680.9211060.0532258
Chitin 1h1444.62170.2950.9883510.0709752
Epi 1h1335.2387.44940.959390.0554374
SA 1h1459.31177.9810.8738410.087424
Me-JA 1h753.3243.75140.5745740.0387901
Control 6h2343.21519.1881.373540.235094
ABA 6h1456.49173.4090.8426920.123405
ACC 6h1802.21216.650.9673150.0558878
BABA 6h1761.05101.840.9817790.0567184
Chitin 6h1902.28110.1751.113460.0643207
Epi 6h1933.69248.991.051790.227052
SA 6h1646.68256.6621.011720.0584579
Me-JA 6h1483.94310.3250.894410.127972

Source Transcript PGSC0003DMT400065178 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G47130.1 +1 4e-52 174 94/171 (55%) NAD(P)-binding Rossmann-fold superfamily protein | chr2:19349627-19350481 REVERSE LENGTH=257

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400065178

Click here to view details at Spud DB Genome Browser (opens in new window)