Probe CUST_50040_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_50040_PI426222305 JHI_St_60k_v1 DMT400065418 CTTGTACGCGGGAAATGATAATGTAAATGACTATGGAACTGTTCAAGAGTACTCATTTTT

All Microarray Probes Designed to Gene DMG400025434

Probe IDChip nameTranscript IDProbe Sequence
CUST_50040_PI426222305 JHI_St_60k_v1 DMT400065418 CTTGTACGCGGGAAATGATAATGTAAATGACTATGGAACTGTTCAAGAGTACTCATTTTT


Microarray Signals from CUST_50040_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h178.20538.93070.7172030.112782
ABA 1h132.37624.0460.6101780.0656945
ACC 1h253.93334.95781.019410.0862853
BABA 1h241.82244.75981.01580.104797
Chitin 1h213.94523.67970.9876130.0874038
Epi 1h181.55112.77520.8774020.0527591
SA 1h231.31117.76130.940880.055709
Me-JA 1h359.32321.0261.845680.10772
Control 6h263.6354.32341.051280.155667
ABA 6h439.19974.10011.685030.209058
ACC 6h277.80723.021.01150.0599206
BABA 6h326.2419.22081.221710.115741
Chitin 6h271.81627.77891.063040.109382
Epi 6h253.02715.06690.9419920.0618192
SA 6h253.5627.70241.064310.0631508
Me-JA 6h322.81237.94981.344670.142964

Source Transcript PGSC0003DMT400065418 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G11760.1 +3 0.0 624 375/737 (51%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04860.1); Has 84 Blast hits to 73 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:3718529-3721123 FORWARD LENGTH=702

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400065418

Click here to view details at Spud DB Genome Browser (opens in new window)