Probe CUST_49862_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_49862_PI426222305 | JHI_St_60k_v1 | DMT400013077 | GTAATGTATTTCACATCCAAATTACTTATACAAACTGAGCAGTTGATCTACCCTACAACC |
All Microarray Probes Designed to Gene DMG400005103
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_49862_PI426222305 | JHI_St_60k_v1 | DMT400013077 | GTAATGTATTTCACATCCAAATTACTTATACAAACTGAGCAGTTGATCTACCCTACAACC |
Microarray Signals from CUST_49862_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 59.5077 | 11.6822 | 1.0352 | 0.141788 |
| ABA 1h | 44.5979 | 4.20727 | 0.908615 | 0.0857636 |
| ACC 1h | 70.4929 | 18.2122 | 1.13492 | 0.273904 |
| BABA 1h | 61.9306 | 7.06114 | 1.14364 | 0.0997436 |
| Chitin 1h | 42.3496 | 4.44422 | 0.84677 | 0.0893033 |
| Epi 1h | 43.9646 | 5.17556 | 0.903245 | 0.093155 |
| SA 1h | 74.7392 | 12.2694 | 1.27205 | 0.155732 |
| Me-JA 1h | 46.5609 | 8.27795 | 0.997196 | 0.134443 |
| Control 6h | 40.9921 | 9.09063 | 0.694476 | 0.118165 |
| ABA 6h | 140.914 | 34.3106 | 2.24468 | 0.45624 |
| ACC 6h | 104.511 | 9.3074 | 1.62943 | 0.116829 |
| BABA 6h | 151.603 | 38.9312 | 2.29411 | 0.538886 |
| Chitin 6h | 48.6656 | 7.20036 | 0.807 | 0.0908662 |
| Epi 6h | 39.8721 | 6.21314 | 0.620529 | 0.0787479 |
| SA 6h | 37.3811 | 5.94791 | 0.663233 | 0.150007 |
| Me-JA 6h | 58.5341 | 20.7259 | 0.932751 | 0.270894 |
Source Transcript PGSC0003DMT400013077 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G09970.2 | +3 | 0.0 | 971 | 540/949 (57%) | Leucine-rich receptor-like protein kinase family protein | chr1:3252408-3255428 FORWARD LENGTH=977 |