Probe CUST_49267_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_49267_PI426222305 JHI_St_60k_v1 DMT400059101 GCTTGTAGGTTGTATAGAAAAATTGAGGTGTTCATGGTAAAAGTGTCTGGATTTCTAGTT

All Microarray Probes Designed to Gene DMG400022956

Probe IDChip nameTranscript IDProbe Sequence
CUST_49267_PI426222305 JHI_St_60k_v1 DMT400059101 GCTTGTAGGTTGTATAGAAAAATTGAGGTGTTCATGGTAAAAGTGTCTGGATTTCTAGTT
CUST_49285_PI426222305 JHI_St_60k_v1 DMT400059103 GCTTGTAGGTTGTATAGAAAAATTGAGGTGTTCATGGTAAAAGTGTCTGGATTTCTAGTT


Microarray Signals from CUST_49267_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h3539.62453.9412.517420.217435
ABA 1h4306.94566.7493.45010.299889
ACC 1h2962.82878.8821.83960.601061
BABA 1h2638.51663.1571.838020.341657
Chitin 1h1721.07129.7841.375010.0885703
Epi 1h2292.2132.451.912130.11043
SA 1h3991.89989.2642.654750.479478
Me-JA 1h1230.54214.0151.058570.0930003
Control 6h735.085162.6360.4996520.0842773
ABA 6h2041.5409.3251.324880.229129
ACC 6h920.44863.28530.5769890.0409017
BABA 6h1302.63165.0870.8263870.0766765
Chitin 6h947.21954.86040.6423140.0371734
Epi 6h1024.94135.6310.6439150.0525295
SA 6h1099.01191.4780.7744630.0589867
Me-JA 6h979.46251.3170.6658050.116592

Source Transcript PGSC0003DMT400059101 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G05190.1 +1 4e-20 96 44/87 (51%) Protein of unknown function (DUF3133) | chr5:1541853-1543875 FORWARD LENGTH=615

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400059101

Click here to view details at Spud DB Genome Browser (opens in new window)