Probe CUST_48331_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_48331_PI426222305 | JHI_St_60k_v1 | DMT400043193 | GATTCTATGATACAACTCAAAAAATGTATGGTCCAAATACTTGAACCCAACTCATTTCCG |
All Microarray Probes Designed to Gene DMG400016765
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_48331_PI426222305 | JHI_St_60k_v1 | DMT400043193 | GATTCTATGATACAACTCAAAAAATGTATGGTCCAAATACTTGAACCCAACTCATTTCCG |
Microarray Signals from CUST_48331_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 6.30017 | 3.13574 | 1.05542 | 0.537974 |
ABA 1h | 5.50554 | 2.96162 | 1.05425 | 0.570629 |
ACC 1h | 6.80275 | 3.52835 | 1.1147 | 0.586192 |
BABA 1h | 8.34315 | 3.33475 | 1.36031 | 0.636145 |
Chitin 1h | 6.52773 | 3.11102 | 1.21222 | 0.605443 |
Epi 1h | 5.26889 | 3.06268 | 1.04745 | 0.598394 |
SA 1h | 5.32246 | 3.08845 | 0.879689 | 0.51028 |
Me-JA 1h | 7.22075 | 3.1705 | 1.43325 | 0.697223 |
Control 6h | 6.74511 | 3.21816 | 1.12605 | 0.557853 |
ABA 6h | 62.0102 | 13.2646 | 9.38523 | 1.8411 |
ACC 6h | 6.44684 | 3.82759 | 0.932135 | 0.539776 |
BABA 6h | 7.68304 | 3.53764 | 1.13835 | 0.553568 |
Chitin 6h | 6.04368 | 3.50647 | 0.963706 | 0.558815 |
Epi 6h | 6.25992 | 3.66783 | 0.933256 | 0.540914 |
SA 6h | 5.76939 | 3.34667 | 0.990588 | 0.574573 |
Me-JA 6h | 9.05627 | 3.36635 | 1.36348 | 0.661634 |
Source Transcript PGSC0003DMT400043193 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G31940.1 | +2 | 1e-43 | 148 | 84/147 (57%) | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35585.1); Has 67 Blast hits to 67 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:11470293-11471154 REVERSE LENGTH=158 |