Probe CUST_47157_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_47157_PI426222305 | JHI_St_60k_v1 | DMT400041331 | ATTCGAAATACTCTATGCATCGGACTATGATGGTGGAGAAGAATCGAAAGTCCAATGAAA |
All Microarray Probes Designed to Gene DMG400016006
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_47157_PI426222305 | JHI_St_60k_v1 | DMT400041331 | ATTCGAAATACTCTATGCATCGGACTATGATGGTGGAGAAGAATCGAAAGTCCAATGAAA |
Microarray Signals from CUST_47157_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 3407.07 | 871.948 | 1.57786 | 0.4951 |
ABA 1h | 3088.41 | 913.907 | 1.60367 | 0.387348 |
ACC 1h | 7363.69 | 2519.72 | 3.06261 | 1.22542 |
BABA 1h | 3407.9 | 660.135 | 1.70675 | 0.193733 |
Chitin 1h | 1816.35 | 153.567 | 1.00822 | 0.162662 |
Epi 1h | 2598.5 | 569.39 | 1.42492 | 0.340231 |
SA 1h | 5914.61 | 683.302 | 2.85158 | 0.386746 |
Me-JA 1h | 4087.31 | 427.858 | 2.48701 | 0.143605 |
Control 6h | 904.946 | 283.81 | 0.409143 | 0.101857 |
ABA 6h | 3448.55 | 502.178 | 1.59465 | 0.152379 |
ACC 6h | 1591.1 | 293.535 | 0.673286 | 0.0525685 |
BABA 6h | 1554.55 | 467.629 | 0.642978 | 0.165527 |
Chitin 6h | 933.792 | 54.0891 | 0.440774 | 0.0255269 |
Epi 6h | 878.364 | 158.6 | 0.379641 | 0.0624082 |
SA 6h | 1259.58 | 217.363 | 0.622563 | 0.101569 |
Me-JA 6h | 1513.26 | 274.506 | 0.734465 | 0.096013 |
Source Transcript PGSC0003DMT400041331 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT4G17500.1 | +2 | 8e-59 | 193 | 121/227 (53%) | ethylene responsive element binding factor 1 | chr4:9759405-9760211 FORWARD LENGTH=268 |