Probe CUST_45797_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_45797_PI426222305 JHI_St_60k_v1 DMT400050270 TAACCTGCCGGTGTGGATCTCAATTTTGCTATATATGTGGAGAAACATGGAGCGAAAGCC

All Microarray Probes Designed to Gene DMG400019526

Probe IDChip nameTranscript IDProbe Sequence
CUST_45797_PI426222305 JHI_St_60k_v1 DMT400050270 TAACCTGCCGGTGTGGATCTCAATTTTGCTATATATGTGGAGAAACATGGAGCGAAAGCC
CUST_45809_PI426222305 JHI_St_60k_v1 DMT400050269 CACATAACCTGCCGGTTAGTTAATTTCTTGTTTAATTTTTATATGGTAGTGTGGCCTGTT


Microarray Signals from CUST_45797_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1560.52154.1551.391720.0804031
ABA 1h953.35455.24120.9679950.0559726
ACC 1h1912.05592.071.494790.451721
BABA 1h1716.9529.8411.415520.409155
Chitin 1h1248.52101.8091.241370.0717407
Epi 1h1385.8880.1841.43940.0831698
SA 1h7702.741823.26.309811.38003
Me-JA 1h656.244148.5130.6888870.0935133
Control 6h651.083122.8650.5604840.0667633
ABA 6h792.115258.8820.5877250.210373
ACC 6h1218.7770.64420.9541330.179597
BABA 6h1453.84361.5841.104630.23822
Chitin 6h478.21258.14450.3985650.0567732
Epi 6h881.827188.4020.6749130.134361
SA 6h1524.74274.1811.335490.11251
Me-JA 6h684.082124.6260.59810.0595634

Source Transcript PGSC0003DMT400050270 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14250.1 +3 6e-64 210 98/268 (37%) RING/U-box superfamily protein | chr3:4745963-4746958 REVERSE LENGTH=303

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400050270

Click here to view details at Spud DB Genome Browser (opens in new window)