Probe CUST_44719_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_44719_PI426222305 JHI_St_60k_v1 DMT400045238 GTTGGAGGAGATATGTTTGAAAGTGTTCCAGAAGGAGATGCTATTTTTATGAAGTTATTG

All Microarray Probes Designed to Gene DMG400017552

Probe IDChip nameTranscript IDProbe Sequence
CUST_44704_PI426222305 JHI_St_60k_v1 DMT400045239 CTGGACGGATAGTCATTGTGTGAAGTTATTGAAAAACTGTTATAAGTCTACACCAACAAA
CUST_44719_PI426222305 JHI_St_60k_v1 DMT400045238 GTTGGAGGAGATATGTTTGAAAGTGTTCCAGAAGGAGATGCTATTTTTATGAAGTTATTG


Microarray Signals from CUST_44719_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h393.696130.6361.091450.286756
ABA 1h256.18940.73670.8678520.0794606
ACC 1h501.041141.1061.395350.334337
BABA 1h404.56248.08491.271250.0743113
Chitin 1h28067.54280.8909970.210935
Epi 1h287.91767.50340.9728960.191874
SA 1h604.773255.6611.526220.74562
Me-JA 1h1058.5170.5083.873610.358973
Control 6h430.218148.9551.151770.355819
ABA 6h135.69253.83710.3356970.165392
ACC 6h352.00474.08270.9006230.134793
BABA 6h433.62287.6071.133340.28646
Chitin 6h337.94677.65580.9261550.20934
Epi 6h246.85147.05220.647110.170998
SA 6h218.94363.24150.6217520.133824
Me-JA 6h859.3798.16572.615780.542902

Source Transcript PGSC0003DMT400045238 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G54160.1 +1 5e-84 258 125/251 (50%) O-methyltransferase 1 | chr5:21982075-21984167 FORWARD LENGTH=363

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400045238

Click here to view details at Spud DB Genome Browser (opens in new window)