Probe CUST_43518_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_43518_PI426222305 JHI_St_60k_v1 DMT400065370 TGCTGGGATTACAAAGTATATTGTACTTCCCCTCGCACATTTGAACGTTTATATATATGT

All Microarray Probes Designed to Gene DMG400025409

Probe IDChip nameTranscript IDProbe Sequence
CUST_43522_PI426222305 JHI_St_60k_v1 DMT400065369 ATCCCATGCCCATGGGCTACTTTACTGAAACAGTGATGGGAGCTTACAACTGCTTTGATT
CUST_43518_PI426222305 JHI_St_60k_v1 DMT400065370 TGCTGGGATTACAAAGTATATTGTACTTCCCCTCGCACATTTGAACGTTTATATATATGT


Microarray Signals from CUST_43518_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1234.44107.2120.8322640.0481076
ABA 1h1152.77196.7950.8556810.121032
ACC 1h998.147358.2540.5345450.270499
BABA 1h1164.21153.4860.805530.0465824
Chitin 1h915.079162.620.6685480.117233
Epi 1h969.912170.8070.7375180.133075
SA 1h1431.4991.80460.9428230.0544812
Me-JA 1h933.20289.59930.7696790.058953
Control 6h1820.73298.0241.196750.110047
ABA 6h3999.42446.0622.522330.165086
ACC 6h1720.02124.0611.013390.0931542
BABA 6h1906.76232.621.138520.104477
Chitin 6h1840.95109.1341.170720.0710138
Epi 6h1961.03168.6021.172370.0677307
SA 6h1910.15250.6791.286970.0743521
Me-JA 6h3197.38394.9412.148180.124049

Source Transcript PGSC0003DMT400065370 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10None-----

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400065370

Click here to view details at Spud DB Genome Browser (opens in new window)