Probe CUST_43185_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_43185_PI426222305 | JHI_St_60k_v1 | DMT400042690 | AAATAGTTTTTAGATAGGGCATTCACTGAAGAACACACTTGTAAAGCGCATCACACAGAT |
All Microarray Probes Designed to Gene DMG400016561
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_43185_PI426222305 | JHI_St_60k_v1 | DMT400042690 | AAATAGTTTTTAGATAGGGCATTCACTGAAGAACACACTTGTAAAGCGCATCACACAGAT |
Microarray Signals from CUST_43185_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 163.393 | 10.0489 | 1.26743 | 0.077767 |
ABA 1h | 113.707 | 27.4278 | 0.942732 | 0.168631 |
ACC 1h | 165.955 | 15.9391 | 1.24637 | 0.130708 |
BABA 1h | 243.263 | 49.2308 | 1.8837 | 0.235758 |
Chitin 1h | 253.836 | 65.0269 | 2.04093 | 0.744576 |
Epi 1h | 202.204 | 31.1066 | 1.77711 | 0.222884 |
SA 1h | 134.981 | 26.4211 | 0.985374 | 0.161834 |
Me-JA 1h | 127.052 | 17.9587 | 1.1884 | 0.112332 |
Control 6h | 42.6316 | 11.5575 | 0.30482 | 0.0638534 |
ABA 6h | 49.7896 | 25.4875 | 0.281355 | 0.199888 |
ACC 6h | 59.5612 | 19.7746 | 0.36573 | 0.0629586 |
BABA 6h | 104.816 | 36.6583 | 0.645042 | 0.23418 |
Chitin 6h | 66.2281 | 20.6968 | 0.443223 | 0.139163 |
Epi 6h | 197.415 | 22.1136 | 1.34656 | 0.166399 |
SA 6h | 29.2375 | 4.22859 | 0.225655 | 0.0339317 |
Me-JA 6h | 39.81 | 23.5182 | 0.191933 | 0.205892 |
Source Transcript PGSC0003DMT400042690 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G29510.1 | +3 | 7e-37 | 128 | 77/147 (52%) | SAUR-like auxin-responsive protein family | chr1:10322683-10323114 FORWARD LENGTH=143 |