Probe CUST_42533_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_42533_PI426222305 | JHI_St_60k_v1 | DMT400079170 | GTCTATCTGTTGGTGAGTTATTGAGCAACTATTAACTTGCTTTTTGGGCTTGGTCTGCTG |
All Microarray Probes Designed to Gene DMG400030813
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_42533_PI426222305 | JHI_St_60k_v1 | DMT400079170 | GTCTATCTGTTGGTGAGTTATTGAGCAACTATTAACTTGCTTTTTGGGCTTGGTCTGCTG |
Microarray Signals from CUST_42533_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 124.755 | 21.1498 | 1.12865 | 0.112363 |
| ABA 1h | 139.125 | 15.0245 | 1.44499 | 0.0895242 |
| ACC 1h | 120.028 | 19.5606 | 1.05962 | 0.131748 |
| BABA 1h | 130.622 | 29.2313 | 1.19268 | 0.176168 |
| Chitin 1h | 88.84 | 6.01621 | 0.918444 | 0.0621281 |
| Epi 1h | 94.1595 | 6.73726 | 1.00647 | 0.0885626 |
| SA 1h | 135.121 | 31.0557 | 1.15397 | 0.354074 |
| Me-JA 1h | 209.593 | 16.8262 | 2.37221 | 0.141752 |
| Control 6h | 118.19 | 28.6958 | 1.02283 | 0.200303 |
| ABA 6h | 155.133 | 27.9966 | 1.30526 | 0.214444 |
| ACC 6h | 80.4766 | 10.4315 | 0.641636 | 0.0476811 |
| BABA 6h | 102.456 | 20.8661 | 0.809421 | 0.16477 |
| Chitin 6h | 68.9174 | 5.36266 | 0.601882 | 0.046829 |
| Epi 6h | 100.879 | 19.2633 | 0.803868 | 0.171002 |
| SA 6h | 47.8218 | 13.831 | 0.407607 | 0.163763 |
| Me-JA 6h | 100.934 | 29.465 | 0.836628 | 0.260853 |
Source Transcript PGSC0003DMT400079170 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G78280.1 | +3 | 7e-11 | 63 | 31/69 (45%) | transferases, transferring glycosyl groups | chr1:29452823-29457118 FORWARD LENGTH=943 |