Probe CUST_40825_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_40825_PI426222305 JHI_St_60k_v1 DMT400073644 TGCCTAAATCCGTTTTCTCTGTTATATTAGGCTCTTCCAAGGTTGACAAACAGAGAAAAA

All Microarray Probes Designed to Gene DMG400028604

Probe IDChip nameTranscript IDProbe Sequence
CUST_40825_PI426222305 JHI_St_60k_v1 DMT400073644 TGCCTAAATCCGTTTTCTCTGTTATATTAGGCTCTTCCAAGGTTGACAAACAGAGAAAAA
CUST_40808_PI426222305 JHI_St_60k_v1 DMT400073645 GGCAAAATTTCAAGCAATCATCTTCATCATGTGGCTCTAAGTGAAATCTACAAATCCTAA
CUST_40841_PI426222305 JHI_St_60k_v1 DMT400073643 AAAGTTCTGCAAAGGGAAGGCAAGCAATGGGAACGTTCTTTTAGATTAGAGATGGAGGAT


Microarray Signals from CUST_40825_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h17.08843.495320.7381110.158274
ABA 1h7.557273.14440.3722080.166204
ACC 1h34.44424.041571.493550.179748
BABA 1h7.778183.440340.3526970.166479
Chitin 1h14.80513.496950.7303560.183351
Epi 1h13.06944.697520.5784550.268933
SA 1h13.12473.259490.5585630.148108
Me-JA 1h7.302593.340530.3945510.186436
Control 6h109.63444.58533.911711.91754
ABA 6h23.868316.12940.6310930.686655
ACC 6h55.621817.58791.994250.316886
BABA 6h94.919819.49463.65310.694303
Chitin 6h113.27232.62934.369261.37573
Epi 6h113.90436.00854.111321.58131
SA 6h38.520710.10331.63010.533527
Me-JA 6h34.979712.92951.361680.454518

Source Transcript PGSC0003DMT400073644 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G54820.1 +3 4e-24 99 54/103 (52%) Protein kinase superfamily protein | chr1:20447370-20450761 FORWARD LENGTH=458

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073644

Click here to view details at Spud DB Genome Browser (opens in new window)