Probe CUST_40193_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_40193_PI426222305 JHI_St_60k_v1 DMT400068388 CAGGTTGAGTTGTATTCTGCTGCTAATTCTGCTTTTCAATACCATGTTATTTTCTACTTG

All Microarray Probes Designed to Gene DMG400026594

Probe IDChip nameTranscript IDProbe Sequence
CUST_40193_PI426222305 JHI_St_60k_v1 DMT400068388 CAGGTTGAGTTGTATTCTGCTGCTAATTCTGCTTTTCAATACCATGTTATTTTCTACTTG


Microarray Signals from CUST_40193_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h37750.72852.232.227440.316036
ABA 1h23369.75687.71.453790.473164
ACC 1h35203.47903.981.924840.322693
BABA 1h17809.11031.431.092910.179825
Chitin 1h20277.34513.411.275590.266773
Epi 1h17910.71109.371.223120.0791532
SA 1h28030.311520.61.37120.676627
Me-JA 1h25896.74472.271.82410.458111
Control 6h21356.35933.681.15840.254347
ABA 6h7152804.220.3944060.0635836
ACC 6h7922.731091.110.4024840.0232383
BABA 6h12236.93114.810.5963310.218591
Chitin 6h16164.1934.3290.8999160.0519571
Epi 6h15864.24153.050.7695790.317382
SA 6h10608.72546.830.6015010.0983611
Me-JA 6h20167.19295.60.9804240.4355

Source Transcript PGSC0003DMT400068388 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14690.1 +1 5e-146 435 228/485 (47%) cytochrome P450, family 72, subfamily A, polypeptide 15 | chr3:4937410-4939310 FORWARD LENGTH=512

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400068388

Click here to view details at Spud DB Genome Browser (opens in new window)