Probe CUST_39140_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_39140_PI426222305 JHI_St_60k_v1 DMT400036326 GCTTTCTCAGGAATGCTTTTTTAGTGTTGAGCTGTGTTTGTCTTGTCCTTGTAAATAATT

All Microarray Probes Designed to Gene DMG400013973

Probe IDChip nameTranscript IDProbe Sequence
CUST_39140_PI426222305 JHI_St_60k_v1 DMT400036326 GCTTTCTCAGGAATGCTTTTTTAGTGTTGAGCTGTGTTTGTCTTGTCCTTGTAAATAATT
CUST_39155_PI426222305 JHI_St_60k_v1 DMT400036325 GTAGAGCACGGAAGAGGTTCGGCGATGGTTACTGGTAACACTGCTTCACTTTTCTTTTTT


Microarray Signals from CUST_39140_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h139.61824.30640.8865770.214665
ABA 1h220.67273.0091.455280.415441
ACC 1h69.415215.39250.4158960.0772807
BABA 1h247.50177.04351.498510.39745
Chitin 1h290.55524.09322.096940.291491
Epi 1h190.80340.961.361680.327222
SA 1h233.48462.51531.377820.369472
Me-JA 1h200.79328.83731.576750.127901
Control 6h131.22236.5920.7927130.179127
ABA 6h990.396178.8575.8850.779828
ACC 6h170.4715.15570.963560.0792016
BABA 6h216.14241.30351.212270.203323
Chitin 6h123.0911.07650.7493960.0583192
Epi 6h143.57422.4410.8098510.0769931
SA 6h125.79426.98490.7849990.103884
Me-JA 6h139.3740.64540.810280.260553

Source Transcript PGSC0003DMT400036326 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10None-----

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400036326

Click here to view details at Spud DB Genome Browser (opens in new window)