Probe CUST_38364_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_38364_PI426222305 | JHI_St_60k_v1 | DMT400043659 | GTAGGATTTTTTGCAAGAAATAAGCGCACACAACTGTTGTCTGTTTTTCGAAAATCTTGT |
All Microarray Probes Designed to Gene DMG400016954
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_38364_PI426222305 | JHI_St_60k_v1 | DMT400043659 | GTAGGATTTTTTGCAAGAAATAAGCGCACACAACTGTTGTCTGTTTTTCGAAAATCTTGT |
Microarray Signals from CUST_38364_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 34.8521 | 4.70376 | 1.66804 | 0.197611 |
ABA 1h | 33.2282 | 6.57145 | 1.7645 | 0.334995 |
ACC 1h | 21.8628 | 8.85096 | 0.852387 | 0.384937 |
BABA 1h | 21.0152 | 6.95854 | 0.952041 | 0.250571 |
Chitin 1h | 9.12341 | 3.03273 | 0.48104 | 0.170566 |
Epi 1h | 20.8011 | 3.70795 | 1.13683 | 0.203516 |
SA 1h | 11.4783 | 3.12717 | 0.516325 | 0.161593 |
Me-JA 1h | 5.51721 | 3.11055 | 0.328975 | 0.184577 |
Control 6h | 20.4332 | 4.88893 | 0.925143 | 0.18406 |
ABA 6h | 46.892 | 4.20408 | 2.13445 | 0.192887 |
ACC 6h | 31.9285 | 4.1834 | 1.34386 | 0.220901 |
BABA 6h | 57.702 | 25.1088 | 2.09607 | 1.01961 |
Chitin 6h | 18.1931 | 4.50915 | 0.769525 | 0.221224 |
Epi 6h | 19.3798 | 3.79032 | 0.835554 | 0.162786 |
SA 6h | 19.9784 | 6.57949 | 0.869215 | 0.239968 |
Me-JA 6h | 21.1819 | 6.35061 | 0.951391 | 0.206116 |
Source Transcript PGSC0003DMT400043659 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT4G02450.1 | +1 | 3e-36 | 133 | 67/142 (47%) | HSP20-like chaperones superfamily protein | chr4:1073987-1075765 REVERSE LENGTH=241 |