Probe CUST_3495_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_3495_PI426222305 JHI_St_60k_v1 DMT400040808 AATCTTGGCTCTAAGAAAAATGATGAAAAAAGGCCTCAAGACCTGCCTCATTCTACCAAG

All Microarray Probes Designed to Gene DMG400015780

Probe IDChip nameTranscript IDProbe Sequence
CUST_3495_PI426222305 JHI_St_60k_v1 DMT400040808 AATCTTGGCTCTAAGAAAAATGATGAAAAAAGGCCTCAAGACCTGCCTCATTCTACCAAG


Microarray Signals from CUST_3495_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h35.58256.029870.8651250.112003
ABA 1h64.86497.033161.820520.176238
ACC 1h74.155819.64651.667650.389639
BABA 1h55.753811.42731.381230.434789
Chitin 1h69.31675.372811.926340.178265
Epi 1h42.53426.989261.20410.159901
SA 1h65.952613.31781.540.463085
Me-JA 1h53.0835.163381.617240.145054
Control 6h25.61157.586010.5699840.169348
ABA 6h210.70712.78164.963740.300558
ACC 6h47.5015.293321.031890.111757
BABA 6h28.69754.787250.6237720.101358
Chitin 6h24.98194.242360.5738550.105002
Epi 6h35.11994.669560.7808640.103381
SA 6h23.86335.466650.5764940.111695
Me-JA 6h25.93024.711940.6294650.143693

Source Transcript PGSC0003DMT400040808 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G66800.1 +1 2e-19 85 50/99 (51%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50640.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | chr5:26671433-26672116 FORWARD LENGTH=183

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400040808

Click here to view details at Spud DB Genome Browser (opens in new window)