Probe CUST_34115_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_34115_PI426222305 JHI_St_60k_v1 DMT400019726 AGGAGGCCCAAAATGTCCTTAAAATCATATGCACTGACGGTGAAAAGAATTTTTATGTTA

All Microarray Probes Designed to Gene DMG400007621

Probe IDChip nameTranscript IDProbe Sequence
CUST_34115_PI426222305 JHI_St_60k_v1 DMT400019726 AGGAGGCCCAAAATGTCCTTAAAATCATATGCACTGACGGTGAAAAGAATTTTTATGTTA


Microarray Signals from CUST_34115_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1110.79212.4761.118760.135853
ABA 1h620.73187.71510.7169470.0952702
ACC 1h1068.64272.8331.015530.197957
BABA 1h706.826113.340.7435790.056649
Chitin 1h628.95980.62770.7178460.132233
Epi 1h693.21453.00660.8309090.0481615
SA 1h927.711163.9170.9114850.235416
Me-JA 1h536.78643.56550.6812070.0911063
Control 6h4807.311471.044.363191.44222
ABA 6h382.32858.34690.3654820.0680436
ACC 6h3813.481774.12.843280.887672
BABA 6h8490.881888.467.535911.54308
Chitin 6h7567.261492.97.083251.41325
Epi 6h5856.011517.185.055111.89337
SA 6h3356.61396.1123.490660.619663
Me-JA 6h1591.63705.6261.305420.665686

Source Transcript PGSC0003DMT400019726 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G74670.1 +3 3e-39 132 53/67 (79%) Gibberellin-regulated family protein | chr1:28053378-28053893 FORWARD LENGTH=101

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400019726

Click here to view details at Spud DB Genome Browser (opens in new window)