Probe CUST_33392_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_33392_PI426222305 | JHI_St_60k_v1 | DMT400017804 | GTGGTCCTTCAAATATTGATGAAGATGATGAAAACTACCACCTACTACATTAAGCTCATA |
All Microarray Probes Designed to Gene DMG400006913
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_33392_PI426222305 | JHI_St_60k_v1 | DMT400017804 | GTGGTCCTTCAAATATTGATGAAGATGATGAAAACTACCACCTACTACATTAAGCTCATA |
Microarray Signals from CUST_33392_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1975.37 | 172.107 | 1.34314 | 0.0865659 |
| ABA 1h | 1190.4 | 351.325 | 0.839352 | 0.333036 |
| ACC 1h | 1483.99 | 485.472 | 0.87973 | 0.271511 |
| BABA 1h | 1081.97 | 286.04 | 0.701751 | 0.157895 |
| Chitin 1h | 670.292 | 113.513 | 0.497317 | 0.0584176 |
| Epi 1h | 1089.04 | 141.518 | 0.84812 | 0.12801 |
| SA 1h | 1141.43 | 320.85 | 0.683658 | 0.222162 |
| Me-JA 1h | 444.383 | 74.0107 | 0.361272 | 0.0457712 |
| Control 6h | 2138.05 | 428.854 | 1.40789 | 0.295137 |
| ABA 6h | 1242.55 | 243.944 | 0.76595 | 0.144852 |
| ACC 6h | 3053.28 | 176.846 | 1.81852 | 0.362188 |
| BABA 6h | 1296.83 | 271.753 | 0.759577 | 0.178365 |
| Chitin 6h | 1903.02 | 121.661 | 1.22003 | 0.0873179 |
| Epi 6h | 1680.95 | 146.733 | 1.01399 | 0.0585795 |
| SA 6h | 1876.71 | 418.512 | 1.23582 | 0.16832 |
| Me-JA 6h | 2362.49 | 510.848 | 1.5348 | 0.461173 |
Source Transcript PGSC0003DMT400017804 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G14570.1 | +3 | 0.0 | 572 | 293/460 (64%) | high affinity nitrate transporter 2.7 | chr5:4695331-4696890 REVERSE LENGTH=493 |