Probe CUST_32654_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_32654_PI426222305 JHI_St_60k_v1 DMT400047278 GTAATTTCAGCTTGGAAGTTGATTAAGGAGTCAGCCATTGCTTTGCTGAGAAAAAGTGTG

All Microarray Probes Designed to Gene DMG400018358

Probe IDChip nameTranscript IDProbe Sequence
CUST_32654_PI426222305 JHI_St_60k_v1 DMT400047278 GTAATTTCAGCTTGGAAGTTGATTAAGGAGTCAGCCATTGCTTTGCTGAGAAAAAGTGTG


Microarray Signals from CUST_32654_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h5.817153.369430.8655040.501172
ABA 1h5.730243.328390.9627340.558419
ACC 1h6.439413.740510.9314360.540139
BABA 1h6.30823.65450.9735470.56374
Chitin 1h6.015773.495010.9925170.574863
Epi 1h5.906293.426451.013750.587032
SA 1h5.904763.426060.8550490.495945
Me-JA 1h7.802363.554271.392320.654629
Control 6h6.716113.680530.9950740.547791
ABA 6h321.286125.70334.562423.5945
ACC 6h297.984118.01733.546318.1388
BABA 6h67.317931.6316.727994.92696
Chitin 6h6.878843.983720.9617050.556938
Epi 6h7.187994.203650.940560.54545
SA 6h6.612983.83660.9946450.576823
Me-JA 6h146.32485.45669.4717246.8241

Source Transcript PGSC0003DMT400047278 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G20340.1 +3 0.0 555 263/481 (55%) Pyridoxal phosphate (PLP)-dependent transferases superfamily protein | chr2:8779804-8782490 FORWARD LENGTH=490

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400047278

Click here to view details at Spud DB Genome Browser (opens in new window)