Probe CUST_27863_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_27863_PI426222305 JHI_St_60k_v1 DMT400015953 CAACAAGCTTACATGAACTACTAGCTGACTTTCAATTGCTGCTTTTTCCTCTTCTTAATA

All Microarray Probes Designed to Gene DMG400006242

Probe IDChip nameTranscript IDProbe Sequence
CUST_27863_PI426222305 JHI_St_60k_v1 DMT400015953 CAACAAGCTTACATGAACTACTAGCTGACTTTCAATTGCTGCTTTTTCCTCTTCTTAATA
CUST_27852_PI426222305 JHI_St_60k_v1 DMT400015951 CTCTTTGTAAATGTCCCTTAAGCCTATAGCGACATCGAATTCAATGACAATTAACTAATG
CUST_27874_PI426222305 JHI_St_60k_v1 DMT400015949 GAAACATAACACATAGAGATCAGTTTGCCATCTTGGCAACAGATGGGGTATGTATTCCCG
CUST_27823_PI426222305 JHI_St_60k_v1 DMT400015952 CAACAAGCTTACATGAACTACTAGCTGACTTTCAATTGCTGCTTTTTCCTCTTCTTAATA
CUST_27883_PI426222305 JHI_St_60k_v1 DMT400015950 TAGATTAGTATCAGTTCAGCTCACCGTTGACCTCAAACCTAACTTACCTCGGGAAAGCGA


Microarray Signals from CUST_27863_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h268.2331.07430.8545090.0651058
ABA 1h173.23925.20380.6191640.0867729
ACC 1h439.252133.8351.268210.510811
BABA 1h263.07955.63730.8412260.111997
Chitin 1h516.875199.8051.615260.631551
Epi 1h193.32124.890.7106170.0985024
SA 1h281.38641.68120.8638390.100929
Me-JA 1h215.83243.8990.8226970.167653
Control 6h578.796200.0781.611070.538588
ABA 6h137.23812.64150.4136590.0383607
ACC 6h518.305140.5641.355560.208423
BABA 6h488.94928.52491.411380.0837095
Chitin 6h464.0539.83191.399130.109348
Epi 6h701.603106.1871.96940.319024
SA 6h368.00148.61791.181460.0694823
Me-JA 6h253.78142.94680.7968180.0923145

Source Transcript PGSC0003DMT400015953 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G05640.1 +1 2e-20 87 39/56 (70%) Protein phosphatase 2C family protein | chr3:1640610-1642227 REVERSE LENGTH=358

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400015953

Click here to view details at Spud DB Genome Browser (opens in new window)