Probe CUST_27502_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_27502_PI426222305 | JHI_St_60k_v1 | DMT400070903 | TTTTTCTCCGATGAAACTAATATTCAAGAGAGTCCATCCTAACACTACGGTGGCTGCGCC |
All Microarray Probes Designed to Gene DMG400027566
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_27502_PI426222305 | JHI_St_60k_v1 | DMT400070903 | TTTTTCTCCGATGAAACTAATATTCAAGAGAGTCCATCCTAACACTACGGTGGCTGCGCC |
Microarray Signals from CUST_27502_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 71.0594 | 5.19736 | 0.915664 | 0.0669303 |
ABA 1h | 66.7878 | 4.89917 | 0.973713 | 0.0872787 |
ACC 1h | 119.943 | 21.7966 | 1.44926 | 0.187539 |
BABA 1h | 89.4574 | 12.3256 | 1.17465 | 0.0826451 |
Chitin 1h | 56.1255 | 10.0197 | 0.776837 | 0.0949688 |
Epi 1h | 55.9086 | 5.6712 | 0.824141 | 0.111514 |
SA 1h | 195.033 | 27.6784 | 2.39912 | 0.290566 |
Me-JA 1h | 55.1005 | 6.56887 | 0.857377 | 0.0715646 |
Control 6h | 76.4781 | 9.1978 | 0.971203 | 0.0881678 |
ABA 6h | 100.104 | 11.8716 | 1.19612 | 0.16113 |
ACC 6h | 131.667 | 25.6074 | 1.41485 | 0.302643 |
BABA 6h | 299.385 | 51.1201 | 3.33918 | 0.651144 |
Chitin 6h | 68.8718 | 5.36025 | 0.833705 | 0.0648752 |
Epi 6h | 125.986 | 29.127 | 1.3469 | 0.497623 |
SA 6h | 67.4301 | 5.19812 | 0.876617 | 0.0677319 |
Me-JA 6h | 36.8851 | 4.96363 | 0.46982 | 0.0504694 |
Source Transcript PGSC0003DMT400070903 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | None | - | - | - | - | - |