Probe CUST_27097_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27097_PI426222305 | JHI_St_60k_v1 | DMT400026353 | CTGCGATCGACCCATAACATTCAAAAATAACTTTATTACATGCCTCACACAGCTAATATT |
All Microarray Probes Designed to Gene DMG400010165
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27097_PI426222305 | JHI_St_60k_v1 | DMT400026353 | CTGCGATCGACCCATAACATTCAAAAATAACTTTATTACATGCCTCACACAGCTAATATT |
Microarray Signals from CUST_27097_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 306.181 | 27.8212 | 1.0793 | 0.0634237 |
| ABA 1h | 181.462 | 44.8534 | 0.688855 | 0.116535 |
| ACC 1h | 382.62 | 80.2865 | 1.26267 | 0.202839 |
| BABA 1h | 317.063 | 19.1413 | 1.16431 | 0.0684876 |
| Chitin 1h | 198.142 | 23.823 | 0.771018 | 0.0726377 |
| Epi 1h | 221.941 | 20.1062 | 0.903136 | 0.0712844 |
| SA 1h | 499.587 | 248.737 | 1.35944 | 0.822029 |
| Me-JA 1h | 749.625 | 76.6445 | 3.22867 | 0.186988 |
| Control 6h | 497.704 | 117.626 | 1.64206 | 0.318123 |
| ABA 6h | 88.522 | 6.22404 | 0.294625 | 0.0237151 |
| ACC 6h | 262.844 | 31.8564 | 0.801449 | 0.147744 |
| BABA 6h | 280.748 | 16.6798 | 0.889527 | 0.0529418 |
| Chitin 6h | 309.926 | 25.4131 | 1.02768 | 0.0791202 |
| Epi 6h | 253.198 | 48.6714 | 0.763154 | 0.2311 |
| SA 6h | 290.739 | 48.8132 | 1.01636 | 0.104406 |
| Me-JA 6h | 593.195 | 34.4658 | 2.11338 | 0.12262 |
Source Transcript PGSC0003DMT400026353 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G25640.2 | +2 | 0.0 | 571 | 314/466 (67%) | detoxifying efflux carrier 35 | chr4:13076576-13078965 REVERSE LENGTH=514 |