Probe CUST_249_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_249_PI426222305 JHI_St_60k_v1 DMT400024237 GTTGCAATAATATGCCTCTGCTGTTTATTGGTGATGTTTTTCTTCCCTGCTTCCTCTCTA

All Microarray Probes Designed to Gene DMG400009360

Probe IDChip nameTranscript IDProbe Sequence
CUST_249_PI426222305 JHI_St_60k_v1 DMT400024237 GTTGCAATAATATGCCTCTGCTGTTTATTGGTGATGTTTTTCTTCCCTGCTTCCTCTCTA


Microarray Signals from CUST_249_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1224.3592.06293.167010.18303
ABA 1h1559.3990.1734.582590.400271
ACC 1h713.953159.2831.702140.319138
BABA 1h431.785112.1181.088540.200914
Chitin 1h332.06236.54640.9500130.121613
Epi 1h447.36972.06611.30610.220262
SA 1h505.22852.93681.266590.147446
Me-JA 1h226.30423.61990.7136550.0424316
Control 6h423.83651.86321.083290.063136
ABA 6h983.472167.5242.327250.339061
ACC 6h360.54943.50960.8065060.0473302
BABA 6h281.87126.2830.6497480.0520951
Chitin 6h324.33819.06140.7924680.0465555
Epi 6h434.35348.66540.9890970.177854
SA 6h256.30144.03450.6536360.0575185
Me-JA 6h217.16731.19490.5549380.037875

Source Transcript PGSC0003DMT400024237 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc04g076340.2 +3 5e-96 290 156/171 (91%) genomic_reference:SL2.50ch04 gene_region:58850229-58852842 transcript_region:SL2.50ch04:58850229..58852842+ functional_description:Unknown Protein (AHRD V1)
TAIR PP10 AT4G38060.2 +3 9e-16 75 41/88 (47%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65480.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | chr4:17873709-17874379 REVERSE LENGTH=136

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400024237

Click here to view details at Spud DB Genome Browser (opens in new window)