Probe CUST_24664_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_24664_PI426222305 JHI_St_60k_v1 DMT400054511 GCACATAGGTGCACTCGATGATTGCCCATTTTTTAAAAAATTAATCAATTTGGTCCCATT

All Microarray Probes Designed to Gene DMG400021157

Probe IDChip nameTranscript IDProbe Sequence
CUST_24664_PI426222305 JHI_St_60k_v1 DMT400054511 GCACATAGGTGCACTCGATGATTGCCCATTTTTTAAAAAATTAATCAATTTGGTCCCATT


Microarray Signals from CUST_24664_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1212.28190.9231.194410.123173
ABA 1h1241.75178.5891.388120.102031
ACC 1h1371.85306.8631.286410.239034
BABA 1h1073.09141.4751.101280.0636902
Chitin 1h1011.39135.11.115220.160708
Epi 1h757.69148.23870.8789220.0508903
SA 1h1243.71366.2011.124870.365451
Me-JA 1h3406.41250.2834.183030.241542
Control 6h711.23178.1870.6734040.115262
ABA 6h1347.6195.0771.253050.10825
ACC 6h468.72667.10590.4041270.100189
BABA 6h544.31433.77930.4883830.0503107
Chitin 6h561.677105.6430.5146430.100509
Epi 6h524.21683.74390.4554910.110541
SA 6h592.43394.05370.5898090.0688538
Me-JA 6h1439.9583.30461.45610.174048

Source Transcript PGSC0003DMT400054511 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G34500.1 +1 0.0 625 299/489 (61%) cytochrome P450, family 710, subfamily A, polypeptide 1 | chr2:14539712-14541199 REVERSE LENGTH=495

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054511

Click here to view details at Spud DB Genome Browser (opens in new window)