Probe CUST_24523_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_24523_PI426222305 JHI_St_60k_v1 DMT400054403 CATCTTCTGTTCCCCAAAAAAGGAGTTAAAATGGAAGTCGTCGCAATCGAATTTTTATTT

All Microarray Probes Designed to Gene DMG400021116

Probe IDChip nameTranscript IDProbe Sequence
CUST_24523_PI426222305 JHI_St_60k_v1 DMT400054403 CATCTTCTGTTCCCCAAAAAAGGAGTTAAAATGGAAGTCGTCGCAATCGAATTTTTATTT


Microarray Signals from CUST_24523_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h111.6547.286711.040270.135452
ABA 1h91.96722.33740.9023420.213934
ACC 1h100.07428.18260.8281020.220103
BABA 1h140.23246.23281.206390.335515
Chitin 1h107.69818.59941.088710.142152
Epi 1h109.2247.110331.179110.0767708
SA 1h168.46939.24151.433010.323807
Me-JA 1h73.514513.03020.8171040.071908
Control 6h76.111821.67680.654690.152517
ABA 6h534.655172.5014.120641.4936
ACC 6h413.78444.84693.336340.782454
BABA 6h387.7596.6053.059910.667968
Chitin 6h72.60987.378410.6315830.0498476
Epi 6h75.425429.24650.5453460.181304
SA 6h70.64521.46470.5930980.155657
Me-JA 6h74.42126.053830.6941420.0513931

Source Transcript PGSC0003DMT400054403 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G49690.1 +1 0.0 540 265/474 (56%) UDP-Glycosyltransferase superfamily protein | chr5:20189968-20191350 REVERSE LENGTH=460

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054403

Click here to view details at Spud DB Genome Browser (opens in new window)